Incidental Mutation 'R8251:Gata6'
ID 640259
Institutional Source Beutler Lab
Gene Symbol Gata6
Ensembl Gene ENSMUSG00000005836
Gene Name GATA binding protein 6
Synonyms
MMRRC Submission 067677-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8251 (G1)
Quality Score 199.009
Status Validated
Chromosome 18
Chromosomal Location 11052510-11085636 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 11054670 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Serine at position 200 (G200S)
Ref Sequence ENSEMBL: ENSMUSP00000041774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047762]
AlphaFold Q61169
Predicted Effect probably benign
Transcript: ENSMUST00000047762
AA Change: G200S

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000041774
Gene: ENSMUSG00000005836
AA Change: G200S

DomainStartEndE-ValueType
low complexity region 14 29 N/A INTRINSIC
low complexity region 32 47 N/A INTRINSIC
low complexity region 84 105 N/A INTRINSIC
Pfam:GATA-N 147 372 2.3e-62 PFAM
ZnF_GATA 378 429 4.23e-16 SMART
ZnF_GATA 432 482 3.62e-24 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a small family of zinc finger transcription factors that play an important role in the regulation of cellular differentiation and organogenesis during vertebrate development. This gene is expressed during early embryogenesis and localizes to endo- and mesodermally derived cells during later embryogenesis and thereby plays an important role in gut, lung, and heart development. Mutations in this gene are associated with several congenital defects. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygous null mutant E5.5 embryos lack parts of the visceral endoderm, show impaired embryonic ectoderm development, and die soon post-implantation, apparently of extraembryonic tissue defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad11 A T 9: 103,968,906 (GRCm39) D463V possibly damaging Het
Adamtsl4 C T 3: 95,591,884 (GRCm39) R68Q probably damaging Het
Ankrd12 A T 17: 66,291,554 (GRCm39) M1293K possibly damaging Het
Arhgap21 T C 2: 20,854,221 (GRCm39) T1724A probably benign Het
C1qtnf12 T C 4: 156,050,916 (GRCm39) I295T probably damaging Het
Cacna1s G T 1: 136,014,461 (GRCm39) G623W probably damaging Het
Cemip2 T C 19: 21,784,765 (GRCm39) V416A possibly damaging Het
Cenpe T A 3: 134,957,445 (GRCm39) probably null Het
Cep85l A T 10: 53,157,450 (GRCm39) I751N probably damaging Het
Corin T A 5: 72,514,269 (GRCm39) D468V probably damaging Het
Ctsr A G 13: 61,310,592 (GRCm39) V51A probably damaging Het
Dnah14 A C 1: 181,492,430 (GRCm39) E1630A probably damaging Het
Dsg4 C A 18: 20,604,221 (GRCm39) A896E probably damaging Het
Ear2 T C 14: 44,340,477 (GRCm39) L45P probably benign Het
Fshr T G 17: 89,507,913 (GRCm39) D43A probably benign Het
Gnaq T A 19: 16,312,419 (GRCm39) M227K probably damaging Het
Ifit1bl1 T C 19: 34,572,232 (GRCm39) Q75R possibly damaging Het
Impg2 A G 16: 56,079,960 (GRCm39) E479G possibly damaging Het
Ints7 C T 1: 191,353,545 (GRCm39) P957L unknown Het
Jmjd1c T C 10: 67,075,068 (GRCm39) V73A noncoding transcript Het
Kansl1 A G 11: 104,315,186 (GRCm39) I284T probably benign Het
Kcnj9 A G 1: 172,154,089 (GRCm39) S12P probably benign Het
Krt16 A G 11: 100,139,196 (GRCm39) probably null Het
Lrguk A T 6: 34,093,374 (GRCm39) T632S probably benign Het
Man2b1 G A 8: 85,821,758 (GRCm39) V687M probably damaging Het
Mroh5 T C 15: 73,655,002 (GRCm39) E653G probably benign Het
Nabp1 A T 1: 51,516,737 (GRCm39) S44T probably benign Het
Nt5dc3 C A 10: 86,656,091 (GRCm39) H256Q probably damaging Het
Or1j15 A C 2: 36,459,467 (GRCm39) N286H probably damaging Het
Or4a81 A T 2: 89,619,567 (GRCm39) I43N probably damaging Het
Or5p50 A G 7: 107,421,776 (GRCm39) I300T probably damaging Het
Pkd2 T C 5: 104,646,353 (GRCm39) V720A probably benign Het
Pnpla6 T A 8: 3,582,399 (GRCm39) N706K probably benign Het
Polr1b C A 2: 128,965,086 (GRCm39) P724Q probably damaging Het
Rbpjl A G 2: 164,255,854 (GRCm39) E366G probably damaging Het
Runx1t1 A G 4: 13,846,947 (GRCm39) T244A possibly damaging Het
Slitrk3 C T 3: 72,956,729 (GRCm39) R681H possibly damaging Het
Slu7 A G 11: 43,330,128 (GRCm39) Y185C probably damaging Het
Snupn T A 9: 56,888,137 (GRCm39) F231L probably damaging Het
Srpk2 G A 5: 23,729,266 (GRCm39) P458S probably benign Het
St3gal5 T A 6: 72,126,144 (GRCm39) F330I probably benign Het
Taf3 T C 2: 9,922,962 (GRCm39) D878G possibly damaging Het
Tex44 A G 1: 86,354,936 (GRCm39) N282D probably benign Het
Tmem126a T C 7: 90,100,094 (GRCm39) I150V probably benign Het
Trbv21 A G 6: 41,179,540 (GRCm39) probably benign Het
Vmn2r70 A T 7: 85,215,186 (GRCm39) L116* probably null Het
Vps36 A G 8: 22,682,932 (GRCm39) T16A probably benign Het
Wdr17 C A 8: 55,110,267 (GRCm39) G837W probably damaging Het
Zfp397 T C 18: 24,093,361 (GRCm39) V282A probably benign Het
Other mutations in Gata6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Gata6 APN 18 11,084,330 (GRCm39) missense possibly damaging 0.47
IGL01328:Gata6 APN 18 11,064,530 (GRCm39) missense probably damaging 0.99
IGL02419:Gata6 APN 18 11,054,220 (GRCm39) missense probably damaging 1.00
Lutsen UTSW 18 11,063,059 (GRCm39) missense possibly damaging 0.65
R0538:Gata6 UTSW 18 11,064,771 (GRCm39) missense probably benign 0.11
R1419:Gata6 UTSW 18 11,064,706 (GRCm39) missense probably benign 0.42
R2000:Gata6 UTSW 18 11,054,113 (GRCm39) missense probably benign 0.04
R3113:Gata6 UTSW 18 11,063,124 (GRCm39) missense probably damaging 1.00
R4765:Gata6 UTSW 18 11,054,394 (GRCm39) missense probably benign
R4855:Gata6 UTSW 18 11,054,497 (GRCm39) missense possibly damaging 0.92
R5368:Gata6 UTSW 18 11,063,059 (GRCm39) missense possibly damaging 0.65
R6805:Gata6 UTSW 18 11,054,460 (GRCm39) missense possibly damaging 0.83
R7192:Gata6 UTSW 18 11,054,475 (GRCm39) missense possibly damaging 0.82
R7206:Gata6 UTSW 18 11,054,850 (GRCm39) missense probably damaging 1.00
R7501:Gata6 UTSW 18 11,054,082 (GRCm39) missense probably damaging 0.97
R7541:Gata6 UTSW 18 11,059,108 (GRCm39) missense probably damaging 1.00
R7736:Gata6 UTSW 18 11,084,379 (GRCm39) missense probably damaging 1.00
R8029:Gata6 UTSW 18 11,054,944 (GRCm39) missense possibly damaging 0.68
R9339:Gata6 UTSW 18 11,054,520 (GRCm39) missense probably damaging 0.98
R9712:Gata6 UTSW 18 11,059,064 (GRCm39) missense possibly damaging 0.68
R9753:Gata6 UTSW 18 11,064,706 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GGAGGAAATGTACCAGACCC -3'
(R):5'- CGATCTGATCTTTACCTGTGCTGG -3'

Sequencing Primer
(F):5'- ATGTACCAGACCCTCGCCG -3'
(R):5'- AGCGAGCTGTACTGGTGCTC -3'
Posted On 2020-07-28