Mutagenetix > Incidental Mutation

Incidental Mutation 'R8251:Gata6'

640259

Institutional Source

Beutler Lab

Gene Symbol

Gata6

Ensembl Gene

ENSMUSG00000005836

Gene Name

GATA binding protein 6

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8251 (G1)

Quality Score

199.009

Status

Validated

Chromosome

Chromosomal Location

11052508-11085635 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 11054670 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Serine at position 200 (G200S)

Ref Sequence

ENSEMBL: ENSMUSP00000041774 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047762]

AlphaFold

Q61169

Predicted Effect

probably benign
Transcript: ENSMUST00000047762
AA Change: G200S

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000041774
Gene: ENSMUSG00000005836
AA Change: G200S

Domain	Start	End	E-Value	Type
low complexity region	14	29	N/A	INTRINSIC
low complexity region	32	47	N/A	INTRINSIC
low complexity region	84	105	N/A	INTRINSIC
Pfam:GATA-N	147	372	2.3e-62	PFAM
ZnF_GATA	378	429	4.23e-16	SMART
ZnF_GATA	432	482	3.62e-24	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.5%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a small family of zinc finger transcription factors that play an important role in the regulation of cellular differentiation and organogenesis during vertebrate development. This gene is expressed during early embryogenesis and localizes to endo- and mesodermally derived cells during later embryogenesis and thereby plays an important role in gut, lung, and heart development. Mutations in this gene are associated with several congenital defects. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygous null mutant E5.5 embryos lack parts of the visceral endoderm, show impaired embryonic ectoderm development, and die soon post-implantation, apparently of extraembryonic tissue defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700019O17Rik	A	G	1: 86,427,214	N282D	probably benign	Het
Acad11	A	T	9: 104,091,707	D463V	possibly damaging	Het
Adamtsl4	C	T	3: 95,684,574	R68Q	probably damaging	Het
Ankrd12	A	T	17: 65,984,559	M1293K	possibly damaging	Het
Arhgap21	T	C	2: 20,849,410	T1724A	probably benign	Het
Cacna1s	G	T	1: 136,086,723	G623W	probably damaging	Het
Cenpe	T	A	3: 135,251,684		probably null	Het
Cep85l	A	T	10: 53,281,354	I751N	probably damaging	Het
Corin	T	A	5: 72,356,926	D468V	probably damaging	Het
Ctsr	A	G	13: 61,162,778	V51A	probably damaging	Het
Dnah14	A	C	1: 181,664,865	E1630A	probably damaging	Het
Dsg4	C	A	18: 20,471,164	A896E	probably damaging	Het
Ear2	T	C	14: 44,103,020	L45P	probably benign	Het
Fam132a	T	C	4: 155,966,459	I295T	probably damaging	Het
Fshr	T	G	17: 89,200,485	D43A	probably benign	Het
Gnaq	T	A	19: 16,335,055	M227K	probably damaging	Het
Ifit1bl1	T	C	19: 34,594,832	Q75R	possibly damaging	Het
Impg2	A	G	16: 56,259,597	E479G	possibly damaging	Het
Ints7	C	T	1: 191,621,433	P957L	unknown	Het
Jmjd1c	T	C	10: 67,239,289	V73A	noncoding transcript	Het
Kansl1	A	G	11: 104,424,360	I284T	probably benign	Het
Kcnj9	A	G	1: 172,326,522	S12P	probably benign	Het
Krt16	A	G	11: 100,248,370		probably null	Het
Lrguk	A	T	6: 34,116,439	T632S	probably benign	Het
Man2b1	G	A	8: 85,095,129	V687M	probably damaging	Het
Mroh5	T	C	15: 73,783,153	E653G	probably benign	Het
Nabp1	A	T	1: 51,477,578	S44T	probably benign	Het
Nt5dc3	C	A	10: 86,820,227	H256Q	probably damaging	Het
Olfr1254	A	T	2: 89,789,223	I43N	probably damaging	Het
Olfr344	A	C	2: 36,569,455	N286H	probably damaging	Het
Olfr469	A	G	7: 107,822,569	I300T	probably damaging	Het
Pkd2	T	C	5: 104,498,487	V720A	probably benign	Het
Pnpla6	T	A	8: 3,532,399	N706K	probably benign	Het
Polr1b	C	A	2: 129,123,166	P724Q	probably damaging	Het
Rbpjl	A	G	2: 164,413,934	E366G	probably damaging	Het
Runx1t1	A	G	4: 13,846,947	T244A	possibly damaging	Het
Slitrk3	C	T	3: 73,049,396	R681H	possibly damaging	Het
Slu7	A	G	11: 43,439,301	Y185C	probably damaging	Het
Snupn	T	A	9: 56,980,853	F231L	probably damaging	Het
Srpk2	G	A	5: 23,524,268	P458S	probably benign	Het
St3gal5	T	A	6: 72,149,160	F330I	probably benign	Het
Taf3	T	C	2: 9,918,151	D878G	possibly damaging	Het
Tmem126a	T	C	7: 90,450,886	I150V	probably benign	Het
Tmem2	T	C	19: 21,807,401	V416A	possibly damaging	Het
Trbv21	A	G	6: 41,202,606		probably benign	Het
Vmn2r70	A	T	7: 85,565,978	L116*	probably null	Het
Vps36	A	G	8: 22,192,916	T16A	probably benign	Het
Wdr17	C	A	8: 54,657,232	G837W	probably damaging	Het
Zfp397	T	C	18: 23,960,304	V282A	probably benign	Het

Other mutations in Gata6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00567:Gata6	APN	18	11084330	missense	possibly damaging	0.47
IGL01328:Gata6	APN	18	11064530	missense	probably damaging	0.99
IGL02419:Gata6	APN	18	11054220	missense	probably damaging	1.00
Lutsen	UTSW	18	11063059	missense	possibly damaging	0.65
R0538:Gata6	UTSW	18	11064771	missense	probably benign	0.11
R1419:Gata6	UTSW	18	11064706	missense	probably benign	0.42
R2000:Gata6	UTSW	18	11054113	missense	probably benign	0.04
R3113:Gata6	UTSW	18	11063124	missense	probably damaging	1.00
R4765:Gata6	UTSW	18	11054394	missense	probably benign
R4855:Gata6	UTSW	18	11054497	missense	possibly damaging	0.92
R5368:Gata6	UTSW	18	11063059	missense	possibly damaging	0.65
R6805:Gata6	UTSW	18	11054460	missense	possibly damaging	0.83
R7192:Gata6	UTSW	18	11054475	missense	possibly damaging	0.82
R7206:Gata6	UTSW	18	11054850	missense	probably damaging	1.00
R7501:Gata6	UTSW	18	11054082	missense	probably damaging	0.97
R7541:Gata6	UTSW	18	11059108	missense	probably damaging	1.00
R7736:Gata6	UTSW	18	11084379	missense	probably damaging	1.00
R8029:Gata6	UTSW	18	11054944	missense	possibly damaging	0.68
R9339:Gata6	UTSW	18	11054520	missense	probably damaging	0.98
R9712:Gata6	UTSW	18	11059064	missense	possibly damaging	0.68
R9753:Gata6	UTSW	18	11064706	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- GGAGGAAATGTACCAGACCC -3'
(R):5'- CGATCTGATCTTTACCTGTGCTGG -3'

Sequencing Primer
(F):5'- ATGTACCAGACCCTCGCCG -3'
(R):5'- AGCGAGCTGTACTGGTGCTC -3'

Posted On

2020-07-28