Incidental Mutation 'R8251:Dsg4'
ID 640260
Institutional Source Beutler Lab
Gene Symbol Dsg4
Ensembl Gene ENSMUSG00000001804
Gene Name desmoglein 4
Synonyms CDHF13, lah
MMRRC Submission 067677-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.507) question?
Stock # R8251 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 20569232-20604878 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 20604221 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Glutamic Acid at position 896 (A896E)
Ref Sequence ENSEMBL: ENSMUSP00000019426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019426]
AlphaFold Q7TMD7
Predicted Effect probably damaging
Transcript: ENSMUST00000019426
AA Change: A896E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019426
Gene: ENSMUSG00000001804
AA Change: A896E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CA 70 155 1.54e-11 SMART
CA 179 267 4.27e-19 SMART
CA 290 384 5.48e-8 SMART
CA 411 495 9.4e-7 SMART
transmembrane domain 634 656 N/A INTRINSIC
low complexity region 724 736 N/A INTRINSIC
Pfam:Cadherin_C 749 849 3.1e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. This gene is expressed in the suprabasal epidermis and hair follicle. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the lanceolate hair phenotype in mice. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice carrying mutations at this locus exhibit abnormalities in hair growth, vibrissae growth, and a thickened epidermis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad11 A T 9: 103,968,906 (GRCm39) D463V possibly damaging Het
Adamtsl4 C T 3: 95,591,884 (GRCm39) R68Q probably damaging Het
Ankrd12 A T 17: 66,291,554 (GRCm39) M1293K possibly damaging Het
Arhgap21 T C 2: 20,854,221 (GRCm39) T1724A probably benign Het
C1qtnf12 T C 4: 156,050,916 (GRCm39) I295T probably damaging Het
Cacna1s G T 1: 136,014,461 (GRCm39) G623W probably damaging Het
Cemip2 T C 19: 21,784,765 (GRCm39) V416A possibly damaging Het
Cenpe T A 3: 134,957,445 (GRCm39) probably null Het
Cep85l A T 10: 53,157,450 (GRCm39) I751N probably damaging Het
Corin T A 5: 72,514,269 (GRCm39) D468V probably damaging Het
Ctsr A G 13: 61,310,592 (GRCm39) V51A probably damaging Het
Dnah14 A C 1: 181,492,430 (GRCm39) E1630A probably damaging Het
Ear2 T C 14: 44,340,477 (GRCm39) L45P probably benign Het
Fshr T G 17: 89,507,913 (GRCm39) D43A probably benign Het
Gata6 G A 18: 11,054,670 (GRCm39) G200S probably benign Het
Gnaq T A 19: 16,312,419 (GRCm39) M227K probably damaging Het
Ifit1bl1 T C 19: 34,572,232 (GRCm39) Q75R possibly damaging Het
Impg2 A G 16: 56,079,960 (GRCm39) E479G possibly damaging Het
Ints7 C T 1: 191,353,545 (GRCm39) P957L unknown Het
Jmjd1c T C 10: 67,075,068 (GRCm39) V73A noncoding transcript Het
Kansl1 A G 11: 104,315,186 (GRCm39) I284T probably benign Het
Kcnj9 A G 1: 172,154,089 (GRCm39) S12P probably benign Het
Krt16 A G 11: 100,139,196 (GRCm39) probably null Het
Lrguk A T 6: 34,093,374 (GRCm39) T632S probably benign Het
Man2b1 G A 8: 85,821,758 (GRCm39) V687M probably damaging Het
Mroh5 T C 15: 73,655,002 (GRCm39) E653G probably benign Het
Nabp1 A T 1: 51,516,737 (GRCm39) S44T probably benign Het
Nt5dc3 C A 10: 86,656,091 (GRCm39) H256Q probably damaging Het
Or1j15 A C 2: 36,459,467 (GRCm39) N286H probably damaging Het
Or4a81 A T 2: 89,619,567 (GRCm39) I43N probably damaging Het
Or5p50 A G 7: 107,421,776 (GRCm39) I300T probably damaging Het
Pkd2 T C 5: 104,646,353 (GRCm39) V720A probably benign Het
Pnpla6 T A 8: 3,582,399 (GRCm39) N706K probably benign Het
Polr1b C A 2: 128,965,086 (GRCm39) P724Q probably damaging Het
Rbpjl A G 2: 164,255,854 (GRCm39) E366G probably damaging Het
Runx1t1 A G 4: 13,846,947 (GRCm39) T244A possibly damaging Het
Slitrk3 C T 3: 72,956,729 (GRCm39) R681H possibly damaging Het
Slu7 A G 11: 43,330,128 (GRCm39) Y185C probably damaging Het
Snupn T A 9: 56,888,137 (GRCm39) F231L probably damaging Het
Srpk2 G A 5: 23,729,266 (GRCm39) P458S probably benign Het
St3gal5 T A 6: 72,126,144 (GRCm39) F330I probably benign Het
Taf3 T C 2: 9,922,962 (GRCm39) D878G possibly damaging Het
Tex44 A G 1: 86,354,936 (GRCm39) N282D probably benign Het
Tmem126a T C 7: 90,100,094 (GRCm39) I150V probably benign Het
Trbv21 A G 6: 41,179,540 (GRCm39) probably benign Het
Vmn2r70 A T 7: 85,215,186 (GRCm39) L116* probably null Het
Vps36 A G 8: 22,682,932 (GRCm39) T16A probably benign Het
Wdr17 C A 8: 55,110,267 (GRCm39) G837W probably damaging Het
Zfp397 T C 18: 24,093,361 (GRCm39) V282A probably benign Het
Other mutations in Dsg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Dsg4 APN 18 20,594,383 (GRCm39) missense probably benign 0.22
IGL01723:Dsg4 APN 18 20,599,567 (GRCm39) missense probably damaging 1.00
IGL02249:Dsg4 APN 18 20,594,361 (GRCm39) missense possibly damaging 0.69
IGL02445:Dsg4 APN 18 20,579,307 (GRCm39) splice site probably benign
IGL02553:Dsg4 APN 18 20,595,577 (GRCm39) missense probably benign
IGL02578:Dsg4 APN 18 20,604,250 (GRCm39) missense possibly damaging 0.94
IGL02634:Dsg4 APN 18 20,591,637 (GRCm39) missense probably benign 0.01
IGL02677:Dsg4 APN 18 20,597,933 (GRCm39) missense possibly damaging 0.62
IGL02741:Dsg4 APN 18 20,604,553 (GRCm39) missense probably benign
IGL02747:Dsg4 APN 18 20,579,995 (GRCm39) missense probably damaging 0.97
IGL03342:Dsg4 APN 18 20,584,880 (GRCm39) missense probably damaging 1.00
burrito UTSW 18 20,584,919 (GRCm39) missense possibly damaging 0.81
woodshed UTSW 18 20,584,929 (GRCm39) nonsense probably null
R0043:Dsg4 UTSW 18 20,586,029 (GRCm39) missense probably damaging 1.00
R0375:Dsg4 UTSW 18 20,603,936 (GRCm39) missense probably damaging 1.00
R0537:Dsg4 UTSW 18 20,591,628 (GRCm39) missense probably damaging 1.00
R0619:Dsg4 UTSW 18 20,594,416 (GRCm39) missense probably benign 0.00
R0622:Dsg4 UTSW 18 20,582,845 (GRCm39) missense possibly damaging 0.51
R0765:Dsg4 UTSW 18 20,587,703 (GRCm39) splice site probably benign
R0786:Dsg4 UTSW 18 20,582,429 (GRCm39) critical splice donor site probably null
R1114:Dsg4 UTSW 18 20,599,540 (GRCm39) missense possibly damaging 0.62
R1249:Dsg4 UTSW 18 20,579,929 (GRCm39) nonsense probably null
R1372:Dsg4 UTSW 18 20,582,733 (GRCm39) splice site probably null
R1382:Dsg4 UTSW 18 20,598,181 (GRCm39) missense probably benign 0.00
R1392:Dsg4 UTSW 18 20,579,304 (GRCm39) splice site probably benign
R1442:Dsg4 UTSW 18 20,595,717 (GRCm39) missense possibly damaging 0.76
R1503:Dsg4 UTSW 18 20,582,736 (GRCm39) missense probably damaging 1.00
R1704:Dsg4 UTSW 18 20,604,646 (GRCm39) missense probably damaging 1.00
R1716:Dsg4 UTSW 18 20,595,518 (GRCm39) nonsense probably null
R1765:Dsg4 UTSW 18 20,589,888 (GRCm39) missense probably benign 0.01
R1817:Dsg4 UTSW 18 20,604,302 (GRCm39) missense probably damaging 1.00
R1982:Dsg4 UTSW 18 20,604,269 (GRCm39) missense probably damaging 1.00
R2025:Dsg4 UTSW 18 20,599,693 (GRCm39) nonsense probably null
R2097:Dsg4 UTSW 18 20,604,101 (GRCm39) missense probably damaging 1.00
R2198:Dsg4 UTSW 18 20,594,499 (GRCm39) missense probably benign
R3551:Dsg4 UTSW 18 20,584,813 (GRCm39) missense probably damaging 1.00
R3742:Dsg4 UTSW 18 20,604,058 (GRCm39) missense probably damaging 1.00
R3853:Dsg4 UTSW 18 20,582,291 (GRCm39) missense probably benign
R3955:Dsg4 UTSW 18 20,582,432 (GRCm39) splice site probably null
R4006:Dsg4 UTSW 18 20,604,022 (GRCm39) missense probably damaging 0.97
R4012:Dsg4 UTSW 18 20,584,919 (GRCm39) missense possibly damaging 0.81
R4171:Dsg4 UTSW 18 20,591,636 (GRCm39) nonsense probably null
R4254:Dsg4 UTSW 18 20,604,595 (GRCm39) missense probably benign 0.07
R4504:Dsg4 UTSW 18 20,594,493 (GRCm39) missense probably benign 0.00
R4559:Dsg4 UTSW 18 20,603,978 (GRCm39) missense probably damaging 1.00
R4607:Dsg4 UTSW 18 20,604,302 (GRCm39) missense probably damaging 1.00
R4612:Dsg4 UTSW 18 20,595,470 (GRCm39) missense probably benign 0.10
R4683:Dsg4 UTSW 18 20,594,466 (GRCm39) missense probably benign
R4700:Dsg4 UTSW 18 20,589,965 (GRCm39) missense possibly damaging 0.91
R4749:Dsg4 UTSW 18 20,579,888 (GRCm39) missense possibly damaging 0.88
R4775:Dsg4 UTSW 18 20,604,184 (GRCm39) missense possibly damaging 0.48
R4809:Dsg4 UTSW 18 20,599,678 (GRCm39) missense possibly damaging 0.82
R5276:Dsg4 UTSW 18 20,579,896 (GRCm39) missense probably benign 0.21
R5426:Dsg4 UTSW 18 20,591,541 (GRCm39) missense probably damaging 1.00
R5767:Dsg4 UTSW 18 20,595,549 (GRCm39) nonsense probably null
R5982:Dsg4 UTSW 18 20,598,226 (GRCm39) missense possibly damaging 0.76
R6280:Dsg4 UTSW 18 20,599,724 (GRCm39) missense probably damaging 1.00
R6305:Dsg4 UTSW 18 20,582,847 (GRCm39) missense probably damaging 1.00
R6489:Dsg4 UTSW 18 20,604,420 (GRCm39) missense possibly damaging 0.93
R7013:Dsg4 UTSW 18 20,591,578 (GRCm39) missense possibly damaging 0.58
R7040:Dsg4 UTSW 18 20,584,909 (GRCm39) missense probably benign 0.01
R7196:Dsg4 UTSW 18 20,599,537 (GRCm39) missense probably damaging 1.00
R7432:Dsg4 UTSW 18 20,579,323 (GRCm39) nonsense probably null
R7438:Dsg4 UTSW 18 20,599,685 (GRCm39) missense probably damaging 0.96
R7490:Dsg4 UTSW 18 20,584,993 (GRCm39) splice site probably null
R7612:Dsg4 UTSW 18 20,604,047 (GRCm39) missense probably damaging 1.00
R7639:Dsg4 UTSW 18 20,582,769 (GRCm39) missense probably damaging 1.00
R7905:Dsg4 UTSW 18 20,587,726 (GRCm39) missense probably damaging 1.00
R8326:Dsg4 UTSW 18 20,582,788 (GRCm39) missense probably benign 0.31
R8554:Dsg4 UTSW 18 20,586,100 (GRCm39) missense probably damaging 1.00
R8911:Dsg4 UTSW 18 20,584,929 (GRCm39) nonsense probably null
R9059:Dsg4 UTSW 18 20,604,182 (GRCm39) missense possibly damaging 0.62
R9508:Dsg4 UTSW 18 20,604,070 (GRCm39) missense probably damaging 1.00
R9607:Dsg4 UTSW 18 20,586,047 (GRCm39) missense probably benign 0.00
R9765:Dsg4 UTSW 18 20,604,334 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGTGGATGACTTAGACGAAAGC -3'
(R):5'- TATCTCAGCAGGCACACAAATG -3'

Sequencing Primer
(F):5'- TTGGATCCAAAGTTCAGGACTCTAGC -3'
(R):5'- GGCACACAAATGTTCCCTTG -3'
Posted On 2020-07-28