Incidental Mutation 'R8251:Dsg4'
ID 640260
Institutional Source Beutler Lab
Gene Symbol Dsg4
Ensembl Gene ENSMUSG00000001804
Gene Name desmoglein 4
Synonyms lah, CDHF13
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.589) question?
Stock # R8251 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 20436175-20471821 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 20471164 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Glutamic Acid at position 896 (A896E)
Ref Sequence ENSEMBL: ENSMUSP00000019426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019426]
AlphaFold Q7TMD7
Predicted Effect probably damaging
Transcript: ENSMUST00000019426
AA Change: A896E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019426
Gene: ENSMUSG00000001804
AA Change: A896E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CA 70 155 1.54e-11 SMART
CA 179 267 4.27e-19 SMART
CA 290 384 5.48e-8 SMART
CA 411 495 9.4e-7 SMART
transmembrane domain 634 656 N/A INTRINSIC
low complexity region 724 736 N/A INTRINSIC
Pfam:Cadherin_C 749 849 3.1e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. This gene is expressed in the suprabasal epidermis and hair follicle. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the lanceolate hair phenotype in mice. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice carrying mutations at this locus exhibit abnormalities in hair growth, vibrissae growth, and a thickened epidermis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019O17Rik A G 1: 86,427,214 N282D probably benign Het
Acad11 A T 9: 104,091,707 D463V possibly damaging Het
Adamtsl4 C T 3: 95,684,574 R68Q probably damaging Het
Ankrd12 A T 17: 65,984,559 M1293K possibly damaging Het
Arhgap21 T C 2: 20,849,410 T1724A probably benign Het
Cacna1s G T 1: 136,086,723 G623W probably damaging Het
Cenpe T A 3: 135,251,684 probably null Het
Cep85l A T 10: 53,281,354 I751N probably damaging Het
Corin T A 5: 72,356,926 D468V probably damaging Het
Ctsr A G 13: 61,162,778 V51A probably damaging Het
Dnah14 A C 1: 181,664,865 E1630A probably damaging Het
Ear2 T C 14: 44,103,020 L45P probably benign Het
Fam132a T C 4: 155,966,459 I295T probably damaging Het
Fshr T G 17: 89,200,485 D43A probably benign Het
Gata6 G A 18: 11,054,670 G200S probably benign Het
Gnaq T A 19: 16,335,055 M227K probably damaging Het
Ifit1bl1 T C 19: 34,594,832 Q75R possibly damaging Het
Impg2 A G 16: 56,259,597 E479G possibly damaging Het
Ints7 C T 1: 191,621,433 P957L unknown Het
Jmjd1c T C 10: 67,239,289 V73A noncoding transcript Het
Kansl1 A G 11: 104,424,360 I284T probably benign Het
Kcnj9 A G 1: 172,326,522 S12P probably benign Het
Krt16 A G 11: 100,248,370 probably null Het
Lrguk A T 6: 34,116,439 T632S probably benign Het
Man2b1 G A 8: 85,095,129 V687M probably damaging Het
Mroh5 T C 15: 73,783,153 E653G probably benign Het
Nabp1 A T 1: 51,477,578 S44T probably benign Het
Nt5dc3 C A 10: 86,820,227 H256Q probably damaging Het
Olfr1254 A T 2: 89,789,223 I43N probably damaging Het
Olfr344 A C 2: 36,569,455 N286H probably damaging Het
Olfr469 A G 7: 107,822,569 I300T probably damaging Het
Pkd2 T C 5: 104,498,487 V720A probably benign Het
Pnpla6 T A 8: 3,532,399 N706K probably benign Het
Polr1b C A 2: 129,123,166 P724Q probably damaging Het
Rbpjl A G 2: 164,413,934 E366G probably damaging Het
Runx1t1 A G 4: 13,846,947 T244A possibly damaging Het
Slitrk3 C T 3: 73,049,396 R681H possibly damaging Het
Slu7 A G 11: 43,439,301 Y185C probably damaging Het
Snupn T A 9: 56,980,853 F231L probably damaging Het
Srpk2 G A 5: 23,524,268 P458S probably benign Het
St3gal5 T A 6: 72,149,160 F330I probably benign Het
Taf3 T C 2: 9,918,151 D878G possibly damaging Het
Tmem126a T C 7: 90,450,886 I150V probably benign Het
Tmem2 T C 19: 21,807,401 V416A possibly damaging Het
Trbv21 A G 6: 41,202,606 probably benign Het
Vmn2r70 A T 7: 85,565,978 L116* probably null Het
Vps36 A G 8: 22,192,916 T16A probably benign Het
Wdr17 C A 8: 54,657,232 G837W probably damaging Het
Zfp397 T C 18: 23,960,304 V282A probably benign Het
Other mutations in Dsg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Dsg4 APN 18 20461326 missense probably benign 0.22
IGL01723:Dsg4 APN 18 20466510 missense probably damaging 1.00
IGL02249:Dsg4 APN 18 20461304 missense possibly damaging 0.69
IGL02445:Dsg4 APN 18 20446250 splice site probably benign
IGL02553:Dsg4 APN 18 20462520 missense probably benign
IGL02578:Dsg4 APN 18 20471193 missense possibly damaging 0.94
IGL02634:Dsg4 APN 18 20458580 missense probably benign 0.01
IGL02677:Dsg4 APN 18 20464876 missense possibly damaging 0.62
IGL02741:Dsg4 APN 18 20471496 missense probably benign
IGL02747:Dsg4 APN 18 20446938 missense probably damaging 0.97
IGL03342:Dsg4 APN 18 20451823 missense probably damaging 1.00
burrito UTSW 18 20451862 missense possibly damaging 0.81
woodshed UTSW 18 20451872 nonsense probably null
R0043:Dsg4 UTSW 18 20452972 missense probably damaging 1.00
R0375:Dsg4 UTSW 18 20470879 missense probably damaging 1.00
R0537:Dsg4 UTSW 18 20458571 missense probably damaging 1.00
R0619:Dsg4 UTSW 18 20461359 missense probably benign 0.00
R0622:Dsg4 UTSW 18 20449788 missense possibly damaging 0.51
R0765:Dsg4 UTSW 18 20454646 splice site probably benign
R0786:Dsg4 UTSW 18 20449372 critical splice donor site probably null
R1114:Dsg4 UTSW 18 20466483 missense possibly damaging 0.62
R1249:Dsg4 UTSW 18 20446872 nonsense probably null
R1372:Dsg4 UTSW 18 20449676 splice site probably null
R1382:Dsg4 UTSW 18 20465124 missense probably benign 0.00
R1392:Dsg4 UTSW 18 20446247 splice site probably benign
R1442:Dsg4 UTSW 18 20462660 missense possibly damaging 0.76
R1503:Dsg4 UTSW 18 20449679 missense probably damaging 1.00
R1704:Dsg4 UTSW 18 20471589 missense probably damaging 1.00
R1716:Dsg4 UTSW 18 20462461 nonsense probably null
R1765:Dsg4 UTSW 18 20456831 missense probably benign 0.01
R1817:Dsg4 UTSW 18 20471245 missense probably damaging 1.00
R1982:Dsg4 UTSW 18 20471212 missense probably damaging 1.00
R2025:Dsg4 UTSW 18 20466636 nonsense probably null
R2097:Dsg4 UTSW 18 20471044 missense probably damaging 1.00
R2198:Dsg4 UTSW 18 20461442 missense probably benign
R3551:Dsg4 UTSW 18 20451756 missense probably damaging 1.00
R3742:Dsg4 UTSW 18 20471001 missense probably damaging 1.00
R3853:Dsg4 UTSW 18 20449234 missense probably benign
R3955:Dsg4 UTSW 18 20449375 splice site probably null
R4006:Dsg4 UTSW 18 20470965 missense probably damaging 0.97
R4012:Dsg4 UTSW 18 20451862 missense possibly damaging 0.81
R4171:Dsg4 UTSW 18 20458579 nonsense probably null
R4254:Dsg4 UTSW 18 20471538 missense probably benign 0.07
R4504:Dsg4 UTSW 18 20461436 missense probably benign 0.00
R4559:Dsg4 UTSW 18 20470921 missense probably damaging 1.00
R4607:Dsg4 UTSW 18 20471245 missense probably damaging 1.00
R4612:Dsg4 UTSW 18 20462413 missense probably benign 0.10
R4683:Dsg4 UTSW 18 20461409 missense probably benign
R4700:Dsg4 UTSW 18 20456908 missense possibly damaging 0.91
R4749:Dsg4 UTSW 18 20446831 missense possibly damaging 0.88
R4775:Dsg4 UTSW 18 20471127 missense possibly damaging 0.48
R4809:Dsg4 UTSW 18 20466621 missense possibly damaging 0.82
R5276:Dsg4 UTSW 18 20446839 missense probably benign 0.21
R5426:Dsg4 UTSW 18 20458484 missense probably damaging 1.00
R5767:Dsg4 UTSW 18 20462492 nonsense probably null
R5982:Dsg4 UTSW 18 20465169 missense possibly damaging 0.76
R6280:Dsg4 UTSW 18 20466667 missense probably damaging 1.00
R6305:Dsg4 UTSW 18 20449790 missense probably damaging 1.00
R6489:Dsg4 UTSW 18 20471363 missense possibly damaging 0.93
R7013:Dsg4 UTSW 18 20458521 missense possibly damaging 0.58
R7040:Dsg4 UTSW 18 20451852 missense probably benign 0.01
R7196:Dsg4 UTSW 18 20466480 missense probably damaging 1.00
R7432:Dsg4 UTSW 18 20446266 nonsense probably null
R7438:Dsg4 UTSW 18 20466628 missense probably damaging 0.96
R7490:Dsg4 UTSW 18 20451936 splice site probably null
R7612:Dsg4 UTSW 18 20470990 missense probably damaging 1.00
R7639:Dsg4 UTSW 18 20449712 missense probably damaging 1.00
R7905:Dsg4 UTSW 18 20454669 missense probably damaging 1.00
R8326:Dsg4 UTSW 18 20449731 missense probably benign 0.31
R8554:Dsg4 UTSW 18 20453043 missense probably damaging 1.00
R8911:Dsg4 UTSW 18 20451872 nonsense probably null
R9059:Dsg4 UTSW 18 20471125 missense possibly damaging 0.62
R9508:Dsg4 UTSW 18 20471013 missense probably damaging 1.00
R9607:Dsg4 UTSW 18 20452990 missense probably benign 0.00
R9765:Dsg4 UTSW 18 20471277 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGTGGATGACTTAGACGAAAGC -3'
(R):5'- TATCTCAGCAGGCACACAAATG -3'

Sequencing Primer
(F):5'- TTGGATCCAAAGTTCAGGACTCTAGC -3'
(R):5'- GGCACACAAATGTTCCCTTG -3'
Posted On 2020-07-28