Incidental Mutation 'R8251:Ifit1bl1'
ID640264
Institutional Source Beutler Lab
Gene Symbol Ifit1bl1
Ensembl Gene ENSMUSG00000079339
Gene Nameinterferon induced protein with tetratricpeptide repeats 1B like 1
SynonymsGm14446
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8251 (G1)
Quality Score205.009
Status Validated
Chromosome19
Chromosomal Location34592888-34601968 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34594832 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 75 (Q75R)
Ref Sequence ENSEMBL: ENSMUSP00000132781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112467] [ENSMUST00000168254]
Predicted Effect possibly damaging
Transcript: ENSMUST00000112467
AA Change: Q75R

PolyPhen 2 Score 0.850 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108086
Gene: ENSMUSG00000079339
AA Change: Q75R

DomainStartEndE-ValueType
TPR 60 93 3.41e1 SMART
TPR 100 133 6.24e1 SMART
TPR 146 179 3.69e1 SMART
low complexity region 217 231 N/A INTRINSIC
TPR 249 282 6.75e1 SMART
TPR 338 371 1.64e1 SMART
low complexity region 417 429 N/A INTRINSIC
TPR 433 466 1.08e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000168254
AA Change: Q75R

PolyPhen 2 Score 0.850 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132781
Gene: ENSMUSG00000079339
AA Change: Q75R

DomainStartEndE-ValueType
TPR 60 93 3.41e1 SMART
TPR 100 133 6.24e1 SMART
TPR 146 179 3.69e1 SMART
low complexity region 217 231 N/A INTRINSIC
TPR 249 282 6.75e1 SMART
TPR 338 371 1.64e1 SMART
low complexity region 417 429 N/A INTRINSIC
TPR 433 466 1.08e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019O17Rik A G 1: 86,427,214 N282D probably benign Het
Acad11 A T 9: 104,091,707 D463V possibly damaging Het
Adamtsl4 C T 3: 95,684,574 R68Q probably damaging Het
Ankrd12 A T 17: 65,984,559 M1293K possibly damaging Het
Arhgap21 T C 2: 20,849,410 T1724A probably benign Het
Cacna1s G T 1: 136,086,723 G623W probably damaging Het
Cenpe T A 3: 135,251,684 probably null Het
Cep85l A T 10: 53,281,354 I751N probably damaging Het
Corin T A 5: 72,356,926 D468V probably damaging Het
Ctsr A G 13: 61,162,778 V51A probably damaging Het
Dnah14 A C 1: 181,664,865 E1630A probably damaging Het
Dsg4 C A 18: 20,471,164 A896E probably damaging Het
Ear2 T C 14: 44,103,020 L45P probably benign Het
Fam132a T C 4: 155,966,459 I295T probably damaging Het
Fshr T G 17: 89,200,485 D43A probably benign Het
Gata6 G A 18: 11,054,670 G200S probably benign Het
Gnaq T A 19: 16,335,055 M227K probably damaging Het
Impg2 A G 16: 56,259,597 E479G possibly damaging Het
Ints7 C T 1: 191,621,433 P957L unknown Het
Jmjd1c T C 10: 67,239,289 V73A noncoding transcript Het
Kansl1 A G 11: 104,424,360 I284T probably benign Het
Kcnj9 A G 1: 172,326,522 S12P probably benign Het
Krt16 A G 11: 100,248,370 probably null Het
Lrguk A T 6: 34,116,439 T632S probably benign Het
Man2b1 G A 8: 85,095,129 V687M probably damaging Het
Mroh5 T C 15: 73,783,153 E653G probably benign Het
Nabp1 A T 1: 51,477,578 S44T probably benign Het
Nt5dc3 C A 10: 86,820,227 H256Q probably damaging Het
Olfr1254 A T 2: 89,789,223 I43N probably damaging Het
Olfr344 A C 2: 36,569,455 N286H probably damaging Het
Olfr469 A G 7: 107,822,569 I300T probably damaging Het
Pkd2 T C 5: 104,498,487 V720A probably benign Het
Pnpla6 T A 8: 3,532,399 N706K probably benign Het
Polr1b C A 2: 129,123,166 P724Q probably damaging Het
Rbpjl A G 2: 164,413,934 E366G probably damaging Het
Runx1t1 A G 4: 13,846,947 T244A possibly damaging Het
Slitrk3 C T 3: 73,049,396 R681H possibly damaging Het
Slu7 A G 11: 43,439,301 Y185C probably damaging Het
Snupn T A 9: 56,980,853 F231L probably damaging Het
Srpk2 G A 5: 23,524,268 P458S probably benign Het
St3gal5 T A 6: 72,149,160 F330I probably benign Het
Taf3 T C 2: 9,918,151 D878G possibly damaging Het
Tmem126a T C 7: 90,450,886 I150V probably benign Het
Tmem2 T C 19: 21,807,401 V416A possibly damaging Het
Trbv21 A G 6: 41,202,606 probably benign Het
Vmn2r70 A T 7: 85,565,978 L116* probably null Het
Vps36 A G 8: 22,192,916 T16A probably benign Het
Wdr17 C A 8: 54,657,232 G837W probably damaging Het
Zfp397 T C 18: 23,960,304 V282A probably benign Het
Other mutations in Ifit1bl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4544001:Ifit1bl1 UTSW 19 34594015 missense possibly damaging 0.79
R0420:Ifit1bl1 UTSW 19 34594514 missense probably damaging 1.00
R1161:Ifit1bl1 UTSW 19 34593696 missense possibly damaging 0.80
R1310:Ifit1bl1 UTSW 19 34593696 missense possibly damaging 0.80
R1483:Ifit1bl1 UTSW 19 34594641 missense possibly damaging 0.88
R1606:Ifit1bl1 UTSW 19 34594044 missense probably benign 0.00
R1753:Ifit1bl1 UTSW 19 34593860 missense probably benign 0.15
R1778:Ifit1bl1 UTSW 19 34594193 missense probably damaging 1.00
R2204:Ifit1bl1 UTSW 19 34594341 missense probably benign 0.23
R2205:Ifit1bl1 UTSW 19 34594341 missense probably benign 0.23
R2442:Ifit1bl1 UTSW 19 34594889 missense probably benign 0.00
R2858:Ifit1bl1 UTSW 19 34594322 missense probably benign 0.01
R3422:Ifit1bl1 UTSW 19 34593950 missense probably benign 0.04
R4081:Ifit1bl1 UTSW 19 34594640 missense possibly damaging 0.63
R4125:Ifit1bl1 UTSW 19 34594788 missense probably damaging 0.99
R4616:Ifit1bl1 UTSW 19 34594610 missense probably damaging 1.00
R4731:Ifit1bl1 UTSW 19 34594321 missense probably benign 0.02
R4732:Ifit1bl1 UTSW 19 34594321 missense probably benign 0.02
R4849:Ifit1bl1 UTSW 19 34594676 missense probably damaging 1.00
R5026:Ifit1bl1 UTSW 19 34593893 missense probably damaging 1.00
R5049:Ifit1bl1 UTSW 19 34594081 nonsense probably null
R5414:Ifit1bl1 UTSW 19 34593924 missense probably damaging 0.99
R5561:Ifit1bl1 UTSW 19 34593797 nonsense probably null
R5586:Ifit1bl1 UTSW 19 34594277 missense probably damaging 0.98
R6345:Ifit1bl1 UTSW 19 34594170 nonsense probably null
R6382:Ifit1bl1 UTSW 19 34594883 missense probably benign 0.16
R6515:Ifit1bl1 UTSW 19 34594499 missense probably damaging 1.00
R7073:Ifit1bl1 UTSW 19 34599267 critical splice donor site probably null
R7180:Ifit1bl1 UTSW 19 34593902 missense probably damaging 1.00
R7210:Ifit1bl1 UTSW 19 34594164 missense probably benign 0.00
R7665:Ifit1bl1 UTSW 19 34594883 missense probably benign 0.16
R7724:Ifit1bl1 UTSW 19 34594005 missense probably benign 0.00
R7783:Ifit1bl1 UTSW 19 34593936 missense probably benign 0.01
R7944:Ifit1bl1 UTSW 19 34593824 missense probably benign 0.00
R8427:Ifit1bl1 UTSW 19 34599266 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGTATGCCACACTTCAACAAGG -3'
(R):5'- TCTATGACAGCCTGGTTGAGC -3'

Sequencing Primer
(F):5'- ACACTCCAGCCTGTATTGGAAGG -3'
(R):5'- GAGCTGAGATGCCATTTCACATG -3'
Posted On2020-07-28