Mutagenetix > Incidental Mutation

Incidental Mutation 'R8251:Ifit1bl1'

640264

Institutional Source

Beutler Lab

Gene Symbol

Ifit1bl1

Ensembl Gene

ENSMUSG00000079339

Gene Name

interferon induced protein with tetratricpeptide repeats 1B like 1

Synonyms

Gm14446

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8251 (G1)

Quality Score

205.009

Status

Validated

Chromosome

Chromosomal Location

34592888-34601968 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 34594832 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Arginine at position 75 (Q75R)

Ref Sequence

ENSEMBL: ENSMUSP00000132781 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112467] [ENSMUST00000168254]

AlphaFold

D3Z6F0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000112467
AA Change: Q75R

PolyPhen 2 Score 0.850 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000108086
Gene: ENSMUSG00000079339
AA Change: Q75R

Domain	Start	End	E-Value	Type
TPR	60	93	3.41e1	SMART
TPR	100	133	6.24e1	SMART
TPR	146	179	3.69e1	SMART
low complexity region	217	231	N/A	INTRINSIC
TPR	249	282	6.75e1	SMART
TPR	338	371	1.64e1	SMART
low complexity region	417	429	N/A	INTRINSIC
TPR	433	466	1.08e1	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000168254
AA Change: Q75R

PolyPhen 2 Score 0.850 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000132781
Gene: ENSMUSG00000079339
AA Change: Q75R

Domain	Start	End	E-Value	Type
TPR	60	93	3.41e1	SMART
TPR	100	133	6.24e1	SMART
TPR	146	179	3.69e1	SMART
low complexity region	217	231	N/A	INTRINSIC
TPR	249	282	6.75e1	SMART
TPR	338	371	1.64e1	SMART
low complexity region	417	429	N/A	INTRINSIC
TPR	433	466	1.08e1	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.5%

Validation Efficiency

100% (50/50)

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700019O17Rik	A	G	1: 86,427,214	N282D	probably benign	Het
Acad11	A	T	9: 104,091,707	D463V	possibly damaging	Het
Adamtsl4	C	T	3: 95,684,574	R68Q	probably damaging	Het
Ankrd12	A	T	17: 65,984,559	M1293K	possibly damaging	Het
Arhgap21	T	C	2: 20,849,410	T1724A	probably benign	Het
Cacna1s	G	T	1: 136,086,723	G623W	probably damaging	Het
Cenpe	T	A	3: 135,251,684		probably null	Het
Cep85l	A	T	10: 53,281,354	I751N	probably damaging	Het
Corin	T	A	5: 72,356,926	D468V	probably damaging	Het
Ctsr	A	G	13: 61,162,778	V51A	probably damaging	Het
Dnah14	A	C	1: 181,664,865	E1630A	probably damaging	Het
Dsg4	C	A	18: 20,471,164	A896E	probably damaging	Het
Ear2	T	C	14: 44,103,020	L45P	probably benign	Het
Fam132a	T	C	4: 155,966,459	I295T	probably damaging	Het
Fshr	T	G	17: 89,200,485	D43A	probably benign	Het
Gata6	G	A	18: 11,054,670	G200S	probably benign	Het
Gnaq	T	A	19: 16,335,055	M227K	probably damaging	Het
Impg2	A	G	16: 56,259,597	E479G	possibly damaging	Het
Ints7	C	T	1: 191,621,433	P957L	unknown	Het
Jmjd1c	T	C	10: 67,239,289	V73A	noncoding transcript	Het
Kansl1	A	G	11: 104,424,360	I284T	probably benign	Het
Kcnj9	A	G	1: 172,326,522	S12P	probably benign	Het
Krt16	A	G	11: 100,248,370		probably null	Het
Lrguk	A	T	6: 34,116,439	T632S	probably benign	Het
Man2b1	G	A	8: 85,095,129	V687M	probably damaging	Het
Mroh5	T	C	15: 73,783,153	E653G	probably benign	Het
Nabp1	A	T	1: 51,477,578	S44T	probably benign	Het
Nt5dc3	C	A	10: 86,820,227	H256Q	probably damaging	Het
Olfr1254	A	T	2: 89,789,223	I43N	probably damaging	Het
Olfr344	A	C	2: 36,569,455	N286H	probably damaging	Het
Olfr469	A	G	7: 107,822,569	I300T	probably damaging	Het
Pkd2	T	C	5: 104,498,487	V720A	probably benign	Het
Pnpla6	T	A	8: 3,532,399	N706K	probably benign	Het
Polr1b	C	A	2: 129,123,166	P724Q	probably damaging	Het
Rbpjl	A	G	2: 164,413,934	E366G	probably damaging	Het
Runx1t1	A	G	4: 13,846,947	T244A	possibly damaging	Het
Slitrk3	C	T	3: 73,049,396	R681H	possibly damaging	Het
Slu7	A	G	11: 43,439,301	Y185C	probably damaging	Het
Snupn	T	A	9: 56,980,853	F231L	probably damaging	Het
Srpk2	G	A	5: 23,524,268	P458S	probably benign	Het
St3gal5	T	A	6: 72,149,160	F330I	probably benign	Het
Taf3	T	C	2: 9,918,151	D878G	possibly damaging	Het
Tmem126a	T	C	7: 90,450,886	I150V	probably benign	Het
Tmem2	T	C	19: 21,807,401	V416A	possibly damaging	Het
Trbv21	A	G	6: 41,202,606		probably benign	Het
Vmn2r70	A	T	7: 85,565,978	L116*	probably null	Het
Vps36	A	G	8: 22,192,916	T16A	probably benign	Het
Wdr17	C	A	8: 54,657,232	G837W	probably damaging	Het
Zfp397	T	C	18: 23,960,304	V282A	probably benign	Het

Other mutations in Ifit1bl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
PIT4544001:Ifit1bl1	UTSW	19	34594015	missense	possibly damaging	0.79
R0420:Ifit1bl1	UTSW	19	34594514	missense	probably damaging	1.00
R1161:Ifit1bl1	UTSW	19	34593696	missense	possibly damaging	0.80
R1310:Ifit1bl1	UTSW	19	34593696	missense	possibly damaging	0.80
R1483:Ifit1bl1	UTSW	19	34594641	missense	possibly damaging	0.88
R1606:Ifit1bl1	UTSW	19	34594044	missense	probably benign	0.00
R1753:Ifit1bl1	UTSW	19	34593860	missense	probably benign	0.15
R1778:Ifit1bl1	UTSW	19	34594193	missense	probably damaging	1.00
R2204:Ifit1bl1	UTSW	19	34594341	missense	probably benign	0.23
R2205:Ifit1bl1	UTSW	19	34594341	missense	probably benign	0.23
R2442:Ifit1bl1	UTSW	19	34594889	missense	probably benign	0.00
R2858:Ifit1bl1	UTSW	19	34594322	missense	probably benign	0.01
R3422:Ifit1bl1	UTSW	19	34593950	missense	probably benign	0.04
R4081:Ifit1bl1	UTSW	19	34594640	missense	possibly damaging	0.63
R4125:Ifit1bl1	UTSW	19	34594788	missense	probably damaging	0.99
R4616:Ifit1bl1	UTSW	19	34594610	missense	probably damaging	1.00
R4731:Ifit1bl1	UTSW	19	34594321	missense	probably benign	0.02
R4732:Ifit1bl1	UTSW	19	34594321	missense	probably benign	0.02
R4849:Ifit1bl1	UTSW	19	34594676	missense	probably damaging	1.00
R5026:Ifit1bl1	UTSW	19	34593893	missense	probably damaging	1.00
R5049:Ifit1bl1	UTSW	19	34594081	nonsense	probably null
R5414:Ifit1bl1	UTSW	19	34593924	missense	probably damaging	0.99
R5561:Ifit1bl1	UTSW	19	34593797	nonsense	probably null
R5586:Ifit1bl1	UTSW	19	34594277	missense	probably damaging	0.98
R6345:Ifit1bl1	UTSW	19	34594170	nonsense	probably null
R6382:Ifit1bl1	UTSW	19	34594883	missense	probably benign	0.16
R6515:Ifit1bl1	UTSW	19	34594499	missense	probably damaging	1.00
R7073:Ifit1bl1	UTSW	19	34599267	critical splice donor site	probably null
R7180:Ifit1bl1	UTSW	19	34593902	missense	probably damaging	1.00
R7210:Ifit1bl1	UTSW	19	34594164	missense	probably benign	0.00
R7665:Ifit1bl1	UTSW	19	34594883	missense	probably benign	0.16
R7724:Ifit1bl1	UTSW	19	34594005	missense	probably benign	0.00
R7783:Ifit1bl1	UTSW	19	34593936	missense	probably benign	0.01
R7944:Ifit1bl1	UTSW	19	34593824	missense	probably benign	0.00
R8427:Ifit1bl1	UTSW	19	34599266	critical splice donor site	probably null
R8474:Ifit1bl1	UTSW	19	34594862	missense	probably damaging	1.00
R8933:Ifit1bl1	UTSW	19	34594013	missense	probably damaging	0.99
R9095:Ifit1bl1	UTSW	19	34594499	missense	probably damaging	1.00
R9282:Ifit1bl1	UTSW	19	34594508	missense	probably benign	0.28
R9314:Ifit1bl1	UTSW	19	34599293	missense	probably benign	0.08
R9432:Ifit1bl1	UTSW	19	34594098	missense	possibly damaging	0.86

Predicted Primers

PCR Primer
(F):5'- TGTATGCCACACTTCAACAAGG -3'
(R):5'- TCTATGACAGCCTGGTTGAGC -3'

Sequencing Primer
(F):5'- ACACTCCAGCCTGTATTGGAAGG -3'
(R):5'- GAGCTGAGATGCCATTTCACATG -3'

Posted On

2020-07-28