Incidental Mutation 'R8250:P2rx3'
ID640267
Institutional Source Beutler Lab
Gene Symbol P2rx3
Ensembl Gene ENSMUSG00000027071
Gene Namepurinergic receptor P2X, ligand-gated ion channel, 3
Synonyms4930513E20Rik, P2X3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R8250 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location84998583-85037462 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 85022391 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 221 (V221G)
Ref Sequence ENSEMBL: ENSMUSP00000028465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028465] [ENSMUST00000111613] [ENSMUST00000111616]
Predicted Effect probably damaging
Transcript: ENSMUST00000028465
AA Change: V221G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000028465
Gene: ENSMUSG00000027071
AA Change: V221G

DomainStartEndE-ValueType
Pfam:P2X_receptor 8 367 1.6e-151 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111613
AA Change: V219G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000107240
Gene: ENSMUSG00000027071
AA Change: V219G

DomainStartEndE-ValueType
Pfam:P2X_receptor 8 372 4.7e-162 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111616
AA Change: V197G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000107243
Gene: ENSMUSG00000027071
AA Change: V197G

DomainStartEndE-ValueType
Pfam:P2X_receptor 8 91 1.2e-32 PFAM
Pfam:P2X_receptor 86 350 3.3e-113 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of purinoceptors for ATP. This receptor functions as a ligand-gated ion channel and may transduce ATP-evoked nociceptor activation. Mouse studies suggest that this receptor is important for peripheral pain responses, and also participates in pathways controlling urinary bladder volume reflexes. It is possible that the development of selective antagonists for this receptor may have a therapeutic potential in pain relief and in the treatment of disorders of urine storage. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show normal ventilatory responses to hypoxia. Mice homozygous for a reporter allele show loss of rapidly desensitizing ATP-gated cation currents in dorsal root ganglion neurons, reduced formalin-evoked pain behavior, and enhanced thermal hyperalgesia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,917,662 S515P probably damaging Het
Adamtsl1 A T 4: 86,342,609 E1027V probably damaging Het
Adrbk1 A G 19: 4,289,934 F375S probably damaging Het
Agbl2 G A 2: 90,797,564 G238R probably damaging Het
Ccdc27 A T 4: 154,041,788 D81E unknown Het
Csrnp3 A G 2: 66,022,218 E330G probably damaging Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Fat1 A G 8: 44,953,299 N1029S probably damaging Het
Ftcd T G 10: 76,581,627 I300R probably damaging Het
Fxr1 T A 3: 34,047,029 Y161* probably null Het
Gabrg2 C T 11: 41,967,552 V250I probably benign Het
Gmcl1 T C 6: 86,721,402 D171G possibly damaging Het
Kat2b T A 17: 53,663,536 I650N probably damaging Het
Lhfp T C 3: 53,043,338 I11T probably benign Het
Mbtd1 A G 11: 93,910,350 Y141C probably damaging Het
Mon1b A T 8: 113,639,719 E449V probably damaging Het
Mrpl47 T C 3: 32,731,233 N112S probably damaging Het
Myo9a T A 9: 59,860,109 H865Q probably damaging Het
Notch3 T C 17: 32,132,336 N1895S probably damaging Het
Nuggc A G 14: 65,641,869 I693V probably benign Het
Oip5 A G 2: 119,615,629 S133P probably benign Het
Olfr1051 T C 2: 86,276,154 E111G probably damaging Het
Olfr1420 A T 19: 11,896,377 M119L probably damaging Het
Olfr685 T C 7: 105,181,311 M16V Het
Opcml A G 9: 28,675,270 I95V probably damaging Het
Prr27 A G 5: 87,842,697 N56S possibly damaging Het
Psmd11 T C 11: 80,445,926 S135P possibly damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Sall3 T C 18: 80,973,528 D395G probably benign Het
Scube2 T C 7: 109,864,170 N62S probably benign Het
Sema6a A T 18: 47,290,115 S275T probably damaging Het
Sirpb1a A T 3: 15,379,044 L382Q possibly damaging Het
Snrpn T A 7: 59,986,885 probably null Het
Sox5 A T 6: 144,155,051 S71T possibly damaging Het
Synpo2l G T 14: 20,662,276 T321K probably benign Het
Tex15 G A 8: 33,565,205 E285K probably null Het
Tmem126b G A 7: 90,469,109 L188F probably damaging Het
Ttll2 T C 17: 7,351,368 T387A probably benign Het
Ttn A G 2: 76,836,811 Y11484H unknown Het
Vmn2r76 T A 7: 86,226,023 Y582F possibly damaging Het
Zfp786 A T 6: 47,820,795 L403Q possibly damaging Het
Other mutations in P2rx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:P2rx3 APN 2 85035272 missense probably damaging 1.00
IGL01775:P2rx3 APN 2 85024157 missense probably benign
IGL01897:P2rx3 APN 2 85023481 critical splice donor site probably benign
IGL02399:P2rx3 APN 2 85023227 missense probably benign
R0928:P2rx3 UTSW 2 85035298 start codon destroyed probably null 0.98
R1428:P2rx3 UTSW 2 85024950 missense possibly damaging 0.91
R1537:P2rx3 UTSW 2 85023481 critical splice donor site probably null
R1678:P2rx3 UTSW 2 85022467 missense possibly damaging 0.90
R4332:P2rx3 UTSW 2 85024861 missense probably benign 0.25
R4897:P2rx3 UTSW 2 85024926 missense probably damaging 1.00
R5052:P2rx3 UTSW 2 84999024 missense probably benign 0.01
R5903:P2rx3 UTSW 2 85000727 missense possibly damaging 0.93
R5917:P2rx3 UTSW 2 85035247 missense probably damaging 1.00
R6614:P2rx3 UTSW 2 85035199 missense probably damaging 1.00
R8512:P2rx3 UTSW 2 85024411 missense probably damaging 0.98
Z1177:P2rx3 UTSW 2 85022476 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- TAGAGTGCTTCCACCAGGTG -3'
(R):5'- ATGGTGCAGGTAGATGCCTC -3'

Sequencing Primer
(F):5'- CACCAGGTGGCATTGTCTTGC -3'
(R):5'- TAGATGCCTCCCCTGGATGTG -3'
Posted On2020-07-28