Incidental Mutation 'R8250:Fxr1'
ID640273
Institutional Source Beutler Lab
Gene Symbol Fxr1
Ensembl Gene ENSMUSG00000027680
Gene Namefragile X mental retardation gene 1, autosomal homolog
Synonyms9530073J07Rik, Fxr1p, Fxr1h, 1110050J02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8250 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location34019943-34070322 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 34047029 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 161 (Y161*)
Ref Sequence ENSEMBL: ENSMUSP00000143392 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001620] [ENSMUST00000167354] [ENSMUST00000197694] [ENSMUST00000198051] [ENSMUST00000200086] [ENSMUST00000200392]
Predicted Effect probably null
Transcript: ENSMUST00000001620
AA Change: Y161*
SMART Domains Protein: ENSMUSP00000001620
Gene: ENSMUSG00000027680
AA Change: Y161*

DomainStartEndE-ValueType
Pfam:Agenet 2 55 4.4e-7 PFAM
Pfam:Agenet 62 120 7.1e-10 PFAM
KH 217 284 3.57e-4 SMART
KH 286 356 1.22e-2 SMART
low complexity region 404 421 N/A INTRINSIC
Pfam:FXR_C1 489 564 1.9e-41 PFAM
low complexity region 572 582 N/A INTRINSIC
Pfam:FXR_C3 610 676 1.3e-29 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000167354
AA Change: Y76*
SMART Domains Protein: ENSMUSP00000130216
Gene: ENSMUSG00000027680
AA Change: Y76*

DomainStartEndE-ValueType
Pfam:Agenet 59 120 3.3e-14 PFAM
KH 217 284 3.57e-4 SMART
KH 286 356 1.22e-2 SMART
Pfam:FXR1P_C 361 380 4.2e-9 PFAM
Pfam:FXR1P_C 379 486 1.5e-41 PFAM
low complexity region 502 510 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000197694
AA Change: Y161*
SMART Domains Protein: ENSMUSP00000142441
Gene: ENSMUSG00000027680
AA Change: Y161*

DomainStartEndE-ValueType
Pfam:Agenet 59 120 3.9e-14 PFAM
KH 217 284 3.57e-4 SMART
KH 286 356 1.22e-2 SMART
Pfam:FXR1P_C 361 380 5e-9 PFAM
Pfam:FXR1P_C 379 486 1.8e-41 PFAM
low complexity region 502 510 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197853
Predicted Effect probably null
Transcript: ENSMUST00000198051
AA Change: Y161*
SMART Domains Protein: ENSMUSP00000142847
Gene: ENSMUSG00000027680
AA Change: Y161*

DomainStartEndE-ValueType
Pfam:Agenet 59 120 1.2e-11 PFAM
KH 217 284 2.2e-6 SMART
KH 286 356 7.5e-5 SMART
Pfam:FXR1P_C 361 515 1.6e-64 PFAM
low complexity region 531 539 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200086
SMART Domains Protein: ENSMUSP00000143562
Gene: ENSMUSG00000027680

DomainStartEndE-ValueType
PDB:3O8V|A 2 40 1e-17 PDB
Predicted Effect probably null
Transcript: ENSMUST00000200392
AA Change: Y161*
SMART Domains Protein: ENSMUSP00000143392
Gene: ENSMUSG00000027680
AA Change: Y161*

DomainStartEndE-ValueType
Pfam:Agenet 59 120 3.3e-14 PFAM
KH 217 284 3.57e-4 SMART
KH 286 356 1.22e-2 SMART
Pfam:FXR1P_C 361 380 4.2e-9 PFAM
Pfam:FXR1P_C 379 486 1.5e-41 PFAM
low complexity region 502 510 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an RNA binding protein that interacts with the functionally-similar proteins FMR1 and FXR2. These proteins shuttle between the nucleus and cytoplasm and associate with polyribosomes, predominantly with the 60S ribosomal subunit. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display neonatal lethality with impaired muscle development. Mice homozygous for a hypomorphic allele display a reduced life span with impaired muscle development, growth retardation, and reduced grip strength. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,917,662 S515P probably damaging Het
Adamtsl1 A T 4: 86,342,609 E1027V probably damaging Het
Adrbk1 A G 19: 4,289,934 F375S probably damaging Het
Agbl2 G A 2: 90,797,564 G238R probably damaging Het
Ccdc27 A T 4: 154,041,788 D81E unknown Het
Csrnp3 A G 2: 66,022,218 E330G probably damaging Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Fat1 A G 8: 44,953,299 N1029S probably damaging Het
Ftcd T G 10: 76,581,627 I300R probably damaging Het
Gabrg2 C T 11: 41,967,552 V250I probably benign Het
Gmcl1 T C 6: 86,721,402 D171G possibly damaging Het
Kat2b T A 17: 53,663,536 I650N probably damaging Het
Lhfp T C 3: 53,043,338 I11T probably benign Het
Mbtd1 A G 11: 93,910,350 Y141C probably damaging Het
Mon1b A T 8: 113,639,719 E449V probably damaging Het
Mrpl47 T C 3: 32,731,233 N112S probably damaging Het
Myo9a T A 9: 59,860,109 H865Q probably damaging Het
Notch3 T C 17: 32,132,336 N1895S probably damaging Het
Nuggc A G 14: 65,641,869 I693V probably benign Het
Oip5 A G 2: 119,615,629 S133P probably benign Het
Olfr1051 T C 2: 86,276,154 E111G probably damaging Het
Olfr1420 A T 19: 11,896,377 M119L probably damaging Het
Olfr685 T C 7: 105,181,311 M16V Het
Opcml A G 9: 28,675,270 I95V probably damaging Het
P2rx3 A C 2: 85,022,391 V221G probably damaging Het
Prr27 A G 5: 87,842,697 N56S possibly damaging Het
Psmd11 T C 11: 80,445,926 S135P possibly damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Sall3 T C 18: 80,973,528 D395G probably benign Het
Scube2 T C 7: 109,864,170 N62S probably benign Het
Sema6a A T 18: 47,290,115 S275T probably damaging Het
Sirpb1a A T 3: 15,379,044 L382Q possibly damaging Het
Snrpn T A 7: 59,986,885 probably null Het
Sox5 A T 6: 144,155,051 S71T possibly damaging Het
Synpo2l G T 14: 20,662,276 T321K probably benign Het
Tex15 G A 8: 33,565,205 E285K probably null Het
Tmem126b G A 7: 90,469,109 L188F probably damaging Het
Ttll2 T C 17: 7,351,368 T387A probably benign Het
Ttn A G 2: 76,836,811 Y11484H unknown Het
Vmn2r76 T A 7: 86,226,023 Y582F possibly damaging Het
Zfp786 A T 6: 47,820,795 L403Q possibly damaging Het
Other mutations in Fxr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00714:Fxr1 APN 3 34047627 splice site probably benign
IGL01598:Fxr1 APN 3 34064232 missense possibly damaging 0.61
Outer_limits UTSW 3 34039543 missense probably benign 0.30
pueblo UTSW 3 34064232 missense possibly damaging 0.61
R1294:Fxr1 UTSW 3 34047052 missense probably benign 0.00
R2134:Fxr1 UTSW 3 34058047 missense probably damaging 1.00
R2405:Fxr1 UTSW 3 34061854 missense probably damaging 1.00
R3023:Fxr1 UTSW 3 34064224 missense probably damaging 1.00
R3055:Fxr1 UTSW 3 34049184 missense probably damaging 1.00
R3056:Fxr1 UTSW 3 34049184 missense probably damaging 1.00
R4009:Fxr1 UTSW 3 34065022 missense probably benign 0.31
R4010:Fxr1 UTSW 3 34065022 missense probably benign 0.31
R4706:Fxr1 UTSW 3 34064129 missense probably damaging 0.99
R4721:Fxr1 UTSW 3 34064232 missense possibly damaging 0.61
R4877:Fxr1 UTSW 3 34047698 missense probably damaging 0.99
R5583:Fxr1 UTSW 3 34068976 missense probably benign 0.18
R6280:Fxr1 UTSW 3 34046252 intron probably benign
R6801:Fxr1 UTSW 3 34054303 missense possibly damaging 0.65
R7203:Fxr1 UTSW 3 34046540 missense possibly damaging 0.76
R7422:Fxr1 UTSW 3 34049220 missense probably damaging 1.00
R7523:Fxr1 UTSW 3 34039543 missense probably benign 0.30
R7785:Fxr1 UTSW 3 34046254 missense
R8195:Fxr1 UTSW 3 34047729 missense probably damaging 1.00
R8809:Fxr1 UTSW 3 34054281 missense possibly damaging 0.75
X0067:Fxr1 UTSW 3 34046044 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- GTGTATAACGGCCACAAAAGAC -3'
(R):5'- TGGTCATAGACAGCTGGGAG -3'

Sequencing Primer
(F):5'- GGCCACAAAAGACACATAATTAGG -3'
(R):5'- CATAGACAGCTGGGAGTAGTTTTATC -3'
Posted On2020-07-28