Incidental Mutation 'R8250:Lhfp'
ID640275
Institutional Source Beutler Lab
Gene Symbol Lhfp
Ensembl Gene ENSMUSG00000048332
Gene Namelipoma HMGIC fusion partner
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R8250 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location53041528-53261679 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53043338 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 11 (I11T)
Ref Sequence ENSEMBL: ENSMUSP00000056364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059562] [ENSMUST00000147139]
Predicted Effect probably benign
Transcript: ENSMUST00000059562
AA Change: I11T

PolyPhen 2 Score 0.206 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000056364
Gene: ENSMUSG00000048332
AA Change: I11T

DomainStartEndE-ValueType
Pfam:L_HGMIC_fpl 8 193 2e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147139
AA Change: I11T

PolyPhen 2 Score 0.206 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000119019
Gene: ENSMUSG00000048332
AA Change: I11T

DomainStartEndE-ValueType
Pfam:L_HGMIC_fpl 8 193 2.1e-62 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the lipoma HMGIC fusion partner (LHFP) gene family, which is a subset of the superfamily of tetraspan transmembrane protein encoding genes. This gene is fused to a high-mobility group gene in a translocation-associated lipoma. Mutations in another LHFP-like gene result in deafness in humans and mice. Alternatively spliced transcript variants have been found; however, their full-length nature is not known. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,917,662 S515P probably damaging Het
Adamtsl1 A T 4: 86,342,609 E1027V probably damaging Het
Adrbk1 A G 19: 4,289,934 F375S probably damaging Het
Agbl2 G A 2: 90,797,564 G238R probably damaging Het
Ccdc27 A T 4: 154,041,788 D81E unknown Het
Csrnp3 A G 2: 66,022,218 E330G probably damaging Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Fat1 A G 8: 44,953,299 N1029S probably damaging Het
Ftcd T G 10: 76,581,627 I300R probably damaging Het
Fxr1 T A 3: 34,047,029 Y161* probably null Het
Gabrg2 C T 11: 41,967,552 V250I probably benign Het
Gmcl1 T C 6: 86,721,402 D171G possibly damaging Het
Kat2b T A 17: 53,663,536 I650N probably damaging Het
Mbtd1 A G 11: 93,910,350 Y141C probably damaging Het
Mon1b A T 8: 113,639,719 E449V probably damaging Het
Mrpl47 T C 3: 32,731,233 N112S probably damaging Het
Myo9a T A 9: 59,860,109 H865Q probably damaging Het
Notch3 T C 17: 32,132,336 N1895S probably damaging Het
Nuggc A G 14: 65,641,869 I693V probably benign Het
Oip5 A G 2: 119,615,629 S133P probably benign Het
Olfr1051 T C 2: 86,276,154 E111G probably damaging Het
Olfr1420 A T 19: 11,896,377 M119L probably damaging Het
Olfr685 T C 7: 105,181,311 M16V Het
Opcml A G 9: 28,675,270 I95V probably damaging Het
P2rx3 A C 2: 85,022,391 V221G probably damaging Het
Prr27 A G 5: 87,842,697 N56S possibly damaging Het
Psmd11 T C 11: 80,445,926 S135P possibly damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Sall3 T C 18: 80,973,528 D395G probably benign Het
Scube2 T C 7: 109,864,170 N62S probably benign Het
Sema6a A T 18: 47,290,115 S275T probably damaging Het
Sirpb1a A T 3: 15,379,044 L382Q possibly damaging Het
Snrpn T A 7: 59,986,885 probably null Het
Sox5 A T 6: 144,155,051 S71T possibly damaging Het
Synpo2l G T 14: 20,662,276 T321K probably benign Het
Tex15 G A 8: 33,565,205 E285K probably null Het
Tmem126b G A 7: 90,469,109 L188F probably damaging Het
Ttll2 T C 17: 7,351,368 T387A probably benign Het
Ttn A G 2: 76,836,811 Y11484H unknown Het
Vmn2r76 T A 7: 86,226,023 Y582F possibly damaging Het
Zfp786 A T 6: 47,820,795 L403Q possibly damaging Het
Other mutations in Lhfp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02538:Lhfp APN 3 53043311 missense probably benign 0.00
IGL03256:Lhfp APN 3 53043553 missense possibly damaging 0.56
R0387:Lhfp UTSW 3 53043328 missense probably benign
R5032:Lhfp UTSW 3 53043433 missense possibly damaging 0.68
R6280:Lhfp UTSW 3 53260514 missense probably damaging 0.99
R7448:Lhfp UTSW 3 53260599 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGGTAATACTGAAACTCTGTTACG -3'
(R):5'- TACAGATCCTCCACTCGGTG -3'

Sequencing Primer
(F):5'- ACTCTGTTACGGCAAGTAGC -3'
(R):5'- CCCTGGAAGGAGGCATAGC -3'
Posted On2020-07-28