Incidental Mutation 'R8250:Prr27'
ID640278
Institutional Source Beutler Lab
Gene Symbol Prr27
Ensembl Gene ENSMUSG00000002240
Gene Nameproline rich 27
Synonyms4930432K09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8250 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location87825686-87846387 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87842697 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 56 (N56S)
Ref Sequence ENSEMBL: ENSMUSP00000098617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002310] [ENSMUST00000101056]
Predicted Effect possibly damaging
Transcript: ENSMUST00000002310
AA Change: N48S

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000002310
Gene: ENSMUSG00000002240
AA Change: N48S

DomainStartEndE-ValueType
low complexity region 49 57 N/A INTRINSIC
low complexity region 104 130 N/A INTRINSIC
low complexity region 137 153 N/A INTRINSIC
low complexity region 179 194 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000101056
AA Change: N56S

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000098617
Gene: ENSMUSG00000002240
AA Change: N56S

DomainStartEndE-ValueType
low complexity region 57 65 N/A INTRINSIC
low complexity region 112 138 N/A INTRINSIC
low complexity region 145 161 N/A INTRINSIC
low complexity region 187 202 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,917,662 S515P probably damaging Het
Adamtsl1 A T 4: 86,342,609 E1027V probably damaging Het
Adrbk1 A G 19: 4,289,934 F375S probably damaging Het
Agbl2 G A 2: 90,797,564 G238R probably damaging Het
Ccdc27 A T 4: 154,041,788 D81E unknown Het
Csrnp3 A G 2: 66,022,218 E330G probably damaging Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Fat1 A G 8: 44,953,299 N1029S probably damaging Het
Ftcd T G 10: 76,581,627 I300R probably damaging Het
Fxr1 T A 3: 34,047,029 Y161* probably null Het
Gabrg2 C T 11: 41,967,552 V250I probably benign Het
Gmcl1 T C 6: 86,721,402 D171G possibly damaging Het
Kat2b T A 17: 53,663,536 I650N probably damaging Het
Lhfp T C 3: 53,043,338 I11T probably benign Het
Mbtd1 A G 11: 93,910,350 Y141C probably damaging Het
Mon1b A T 8: 113,639,719 E449V probably damaging Het
Mrpl47 T C 3: 32,731,233 N112S probably damaging Het
Myo9a T A 9: 59,860,109 H865Q probably damaging Het
Notch3 T C 17: 32,132,336 N1895S probably damaging Het
Nuggc A G 14: 65,641,869 I693V probably benign Het
Oip5 A G 2: 119,615,629 S133P probably benign Het
Olfr1051 T C 2: 86,276,154 E111G probably damaging Het
Olfr1420 A T 19: 11,896,377 M119L probably damaging Het
Olfr685 T C 7: 105,181,311 M16V Het
Opcml A G 9: 28,675,270 I95V probably damaging Het
P2rx3 A C 2: 85,022,391 V221G probably damaging Het
Psmd11 T C 11: 80,445,926 S135P possibly damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Sall3 T C 18: 80,973,528 D395G probably benign Het
Scube2 T C 7: 109,864,170 N62S probably benign Het
Sema6a A T 18: 47,290,115 S275T probably damaging Het
Sirpb1a A T 3: 15,379,044 L382Q possibly damaging Het
Snrpn T A 7: 59,986,885 probably null Het
Sox5 A T 6: 144,155,051 S71T possibly damaging Het
Synpo2l G T 14: 20,662,276 T321K probably benign Het
Tex15 G A 8: 33,565,205 E285K probably null Het
Tmem126b G A 7: 90,469,109 L188F probably damaging Het
Ttll2 T C 17: 7,351,368 T387A probably benign Het
Ttn A G 2: 76,836,811 Y11484H unknown Het
Vmn2r76 T A 7: 86,226,023 Y582F possibly damaging Het
Zfp786 A T 6: 47,820,795 L403Q possibly damaging Het
Other mutations in Prr27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02027:Prr27 APN 5 87843443 missense possibly damaging 0.90
IGL02617:Prr27 APN 5 87842659 missense probably benign 0.00
IGL02995:Prr27 APN 5 87842816 missense probably benign
IGL03270:Prr27 APN 5 87835678 utr 5 prime probably benign
R0531:Prr27 UTSW 5 87842678 missense probably benign 0.02
R0637:Prr27 UTSW 5 87851146 unclassified probably benign
R1498:Prr27 UTSW 5 87850741 unclassified probably benign
R1599:Prr27 UTSW 5 87843225 missense probably benign 0.00
R1744:Prr27 UTSW 5 87843047 missense possibly damaging 0.46
R1980:Prr27 UTSW 5 87843402 missense probably benign 0.03
R4033:Prr27 UTSW 5 87843305 nonsense probably null
R4304:Prr27 UTSW 5 87842907 missense probably benign 0.00
R4306:Prr27 UTSW 5 87842907 missense probably benign 0.00
R4307:Prr27 UTSW 5 87842907 missense probably benign 0.00
R4308:Prr27 UTSW 5 87842907 missense probably benign 0.00
R4347:Prr27 UTSW 5 87842672 missense possibly damaging 0.46
R4675:Prr27 UTSW 5 87843241 missense possibly damaging 0.94
R4826:Prr27 UTSW 5 87850966 unclassified probably benign
R4908:Prr27 UTSW 5 87843029 missense probably benign 0.01
R5361:Prr27 UTSW 5 87843344 missense probably damaging 0.96
R5426:Prr27 UTSW 5 87850885 unclassified probably benign
R7268:Prr27 UTSW 5 87843276 missense probably damaging 0.99
R7785:Prr27 UTSW 5 87843272 missense probably benign
R8087:Prr27 UTSW 5 87846309 missense probably benign 0.00
R8270:Prr27 UTSW 5 87846312 missense possibly damaging 0.82
R8375:Prr27 UTSW 5 87842851 nonsense probably null
Z1088:Prr27 UTSW 5 87842646 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTGCTTCTCCTTCAGTTTAGG -3'
(R):5'- TATGACAAAGGGGTATGGCCTG -3'

Sequencing Primer
(F):5'- TCCTTCAGTTTAGGTTTGTTATCTTC -3'
(R):5'- CCTGGGAGGAAAGTGTTTGGGAG -3'
Posted On2020-07-28