Incidental Mutation 'R0095:Necab1'
ID64028
Institutional Source Beutler Lab
Gene Symbol Necab1
Ensembl Gene ENSMUSG00000040536
Gene NameN-terminal EF-hand calcium binding protein 1
Synonyms1700003H21Rik, Efcbp1, NECAB1, STIP-1
MMRRC Submission 038381-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R0095 (G1)
Quality Score120
Status Not validated
Chromosome4
Chromosomal Location14952245-15149794 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 14960027 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 307 (N307Y)
Ref Sequence ENSEMBL: ENSMUSP00000103908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041606] [ENSMUST00000108273]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041606
AA Change: N307Y

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000038165
Gene: ENSMUSG00000040536
AA Change: N307Y

DomainStartEndE-ValueType
low complexity region 4 25 N/A INTRINSIC
EFh 30 58 4.06e-2 SMART
EFh 64 92 6.56e0 SMART
coiled coil region 135 163 N/A INTRINSIC
coiled coil region 209 244 N/A INTRINSIC
Pfam:ABM 251 326 2.1e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108273
AA Change: N307Y

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103908
Gene: ENSMUSG00000040536
AA Change: N307Y

DomainStartEndE-ValueType
low complexity region 4 25 N/A INTRINSIC
EFh 30 58 4.06e-2 SMART
EFh 64 92 6.56e0 SMART
coiled coil region 135 163 N/A INTRINSIC
coiled coil region 209 244 N/A INTRINSIC
Pfam:ABM 251 326 2.4e-13 PFAM
Meta Mutation Damage Score 0.1467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anxa8 G A 14: 34,086,071 A6T probably benign Het
Bicc1 T A 10: 70,961,158 I42F probably damaging Het
Cutc T C 19: 43,753,199 W13R probably benign Het
F5 A T 1: 164,191,968 R671* probably null Het
Fam84b T C 15: 60,823,576 Y107C probably damaging Het
Fer A T 17: 63,941,326 E361V possibly damaging Het
Hnrnpa3 G T 2: 75,661,696 R52L probably damaging Het
Igsf10 A T 3: 59,331,196 Y521* probably null Het
Mmp1a G A 9: 7,465,620 G186D possibly damaging Het
Naip1 T C 13: 100,423,083 T1138A probably benign Het
Olfr510 A C 7: 108,668,045 I210L probably benign Het
Plekha5 T C 6: 140,528,597 F84L probably damaging Het
Rpl6 T G 5: 121,205,839 V115G possibly damaging Het
Sec16a A T 2: 26,425,760 probably null Het
Tpsg1 T C 17: 25,372,554 W43R probably damaging Het
Unc45a T C 7: 80,329,543 D567G probably damaging Het
Usp30 T A 5: 114,105,840 F157I probably damaging Het
Zfp345 T A 2: 150,472,300 H439L probably damaging Het
Other mutations in Necab1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Necab1 APN 4 15052656 missense probably damaging 1.00
IGL01314:Necab1 APN 4 15005079 missense probably damaging 0.96
IGL01751:Necab1 APN 4 14978171 missense probably damaging 1.00
IGL02098:Necab1 APN 4 14955892 utr 3 prime probably benign
IGL02381:Necab1 APN 4 15148812 splice site probably null
IGL03247:Necab1 APN 4 14960046 missense probably benign
R0095:Necab1 UTSW 4 14960027 missense possibly damaging 0.95
R0321:Necab1 UTSW 4 14960083 missense probably damaging 0.99
R0698:Necab1 UTSW 4 15005041 missense probably benign 0.26
R1125:Necab1 UTSW 4 15111257 missense probably damaging 1.00
R1251:Necab1 UTSW 4 15111192 critical splice donor site probably null
R1400:Necab1 UTSW 4 14975185 missense possibly damaging 0.71
R1505:Necab1 UTSW 4 14960047 missense probably benign 0.26
R1771:Necab1 UTSW 4 15111267 missense probably damaging 1.00
R1776:Necab1 UTSW 4 15111267 missense probably damaging 1.00
R2080:Necab1 UTSW 4 15140219 splice site probably benign
R4705:Necab1 UTSW 4 15052628 missense probably damaging 1.00
R4780:Necab1 UTSW 4 14989248 missense probably benign 0.18
R4795:Necab1 UTSW 4 15111208 missense possibly damaging 0.84
R4972:Necab1 UTSW 4 14978216 missense probably damaging 1.00
R5009:Necab1 UTSW 4 14947503 unclassified probably benign
R6102:Necab1 UTSW 4 14989211 missense probably benign 0.05
R6968:Necab1 UTSW 4 14957852 missense probably damaging 1.00
R7458:Necab1 UTSW 4 15111244 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AGATCGTCCTGGGCAACTGAATGG -3'
(R):5'- GAAGTCTTCCTTGGTTGGTCTCCAC -3'

Sequencing Primer
(F):5'- CAGGGCTTCTgggatgtaacag -3'
(R):5'- CTTCATTGAGGCAAACTTAGACAGC -3'
Posted On2013-08-06