Incidental Mutation 'R8250:Snrpn'
ID640282
Institutional Source Beutler Lab
Gene Symbol Snrpn
Ensembl Gene ENSMUSG00000102252
Gene Namesmall nuclear ribonucleoprotein N
Synonyms2410045I01Rik, Peg4, Pwcr1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.231) question?
Stock #R8250 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location59982495-60140219 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to A at 59986885 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000055941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059305] [ENSMUST00000098402] [ENSMUST00000179360] [ENSMUST00000189432]
Predicted Effect probably null
Transcript: ENSMUST00000059305
SMART Domains Protein: ENSMUSP00000055941
Gene: ENSMUSG00000102252

DomainStartEndE-ValueType
Sm 7 82 9.25e-25 SMART
low complexity region 93 119 N/A INTRINSIC
low complexity region 148 164 N/A INTRINSIC
low complexity region 169 209 N/A INTRINSIC
low complexity region 212 240 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098402
SMART Domains Protein: ENSMUSP00000096003
Gene: ENSMUSG00000102252

DomainStartEndE-ValueType
Sm 7 82 9.25e-25 SMART
low complexity region 93 119 N/A INTRINSIC
low complexity region 148 164 N/A INTRINSIC
low complexity region 169 209 N/A INTRINSIC
low complexity region 212 240 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179360
SMART Domains Protein: ENSMUSP00000136053
Gene: ENSMUSG00000000948

DomainStartEndE-ValueType
Pfam:SNURF 1 70 4.4e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189432
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is one polypeptide of a small nuclear ribonucleoprotein complex, and it plays a role in pre-mRNA processing. Although individual snRNPs are believed to recognize specific nucleic acid sequences through RNA-RNA base pairing, the specific role of this family member is unknown. This protein arises from a bicistronic transcript that also encodes a protein identified as the Snrpn upstream reading frame (Snurf). Multiple transcription initiation sites have been identified and extensive alternative splicing occurs in the 5' untranslated region. Additional splice variants have been described but sequences for the complete transcripts have not been determined. The 5' UTR of this gene has been identified as an imprinting center. Alternative splicing or deletion caused by a translocation event in this paternally-expressed region in human and mouse is responsible for Angelman syndrome or Prader-Willi syndrome due to parental imprint switch failure. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted intragenic deletions are phenotypically normal. Deletions that also encompass neighboring genes on the paternal chromosome exhibit growth retardation, hypotonia, and high mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,917,662 S515P probably damaging Het
Adamtsl1 A T 4: 86,342,609 E1027V probably damaging Het
Adrbk1 A G 19: 4,289,934 F375S probably damaging Het
Agbl2 G A 2: 90,797,564 G238R probably damaging Het
Ccdc27 A T 4: 154,041,788 D81E unknown Het
Csrnp3 A G 2: 66,022,218 E330G probably damaging Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Fat1 A G 8: 44,953,299 N1029S probably damaging Het
Ftcd T G 10: 76,581,627 I300R probably damaging Het
Fxr1 T A 3: 34,047,029 Y161* probably null Het
Gabrg2 C T 11: 41,967,552 V250I probably benign Het
Gmcl1 T C 6: 86,721,402 D171G possibly damaging Het
Kat2b T A 17: 53,663,536 I650N probably damaging Het
Lhfp T C 3: 53,043,338 I11T probably benign Het
Mbtd1 A G 11: 93,910,350 Y141C probably damaging Het
Mon1b A T 8: 113,639,719 E449V probably damaging Het
Mrpl47 T C 3: 32,731,233 N112S probably damaging Het
Myo9a T A 9: 59,860,109 H865Q probably damaging Het
Notch3 T C 17: 32,132,336 N1895S probably damaging Het
Nuggc A G 14: 65,641,869 I693V probably benign Het
Oip5 A G 2: 119,615,629 S133P probably benign Het
Olfr1051 T C 2: 86,276,154 E111G probably damaging Het
Olfr1420 A T 19: 11,896,377 M119L probably damaging Het
Olfr685 T C 7: 105,181,311 M16V Het
Opcml A G 9: 28,675,270 I95V probably damaging Het
P2rx3 A C 2: 85,022,391 V221G probably damaging Het
Prr27 A G 5: 87,842,697 N56S possibly damaging Het
Psmd11 T C 11: 80,445,926 S135P possibly damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Sall3 T C 18: 80,973,528 D395G probably benign Het
Scube2 T C 7: 109,864,170 N62S probably benign Het
Sema6a A T 18: 47,290,115 S275T probably damaging Het
Sirpb1a A T 3: 15,379,044 L382Q possibly damaging Het
Sox5 A T 6: 144,155,051 S71T possibly damaging Het
Synpo2l G T 14: 20,662,276 T321K probably benign Het
Tex15 G A 8: 33,565,205 E285K probably null Het
Tmem126b G A 7: 90,469,109 L188F probably damaging Het
Ttll2 T C 17: 7,351,368 T387A probably benign Het
Ttn A G 2: 76,836,811 Y11484H unknown Het
Vmn2r76 T A 7: 86,226,023 Y582F possibly damaging Het
Zfp786 A T 6: 47,820,795 L403Q possibly damaging Het
Other mutations in Snrpn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02081:Snrpn APN 7 59987446 missense possibly damaging 0.80
IGL03349:Snrpn APN 7 59985865 missense probably damaging 0.99
R0032:Snrpn UTSW 7 59985082 missense probably damaging 0.99
R1789:Snrpn UTSW 7 59983459 utr 3 prime probably benign
R2057:Snrpn UTSW 7 59987456 missense possibly damaging 0.95
R4621:Snrpn UTSW 7 59987526 missense possibly damaging 0.84
R7600:Snrpn UTSW 7 59988603 start codon destroyed probably null 0.61
R7664:Snrpn UTSW 7 59987491 missense probably benign 0.15
R8183:Snrpn UTSW 7 59985082 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCAGTACATAGGTGCATAGGTG -3'
(R):5'- TATTGACGCATTCACAGGAAAC -3'

Sequencing Primer
(F):5'- CTTAATTCCTAAGGCTACAGATGTAC -3'
(R):5'- CGCATTCACAGGAAACTAATTTTAC -3'
Posted On2020-07-28