Incidental Mutation 'R8250:Olfr685'
ID640285
Institutional Source Beutler Lab
Gene Symbol Olfr685
Ensembl Gene ENSMUSG00000047794
Gene Nameolfactory receptor 685
SynonymsGA_x6K02T2PBJ9-7810071-7809121, MOR37-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R8250 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location105178416-105186012 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105181311 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 16 (M16V)
Ref Sequence ENSEMBL: ENSMUSP00000061561 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051355] [ENSMUST00000209409]
Predicted Effect
SMART Domains Protein: ENSMUSP00000061561
Gene: ENSMUSG00000047794
AA Change: M16V

DomainStartEndE-ValueType
Pfam:7tm_4 34 313 3e-107 PFAM
Pfam:7TM_GPCR_Srsx 38 217 2.9e-8 PFAM
Pfam:7tm_1 44 295 7e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000209409
AA Change: M1V
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,917,662 S515P probably damaging Het
Adamtsl1 A T 4: 86,342,609 E1027V probably damaging Het
Adrbk1 A G 19: 4,289,934 F375S probably damaging Het
Agbl2 G A 2: 90,797,564 G238R probably damaging Het
Ccdc27 A T 4: 154,041,788 D81E unknown Het
Csrnp3 A G 2: 66,022,218 E330G probably damaging Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Fat1 A G 8: 44,953,299 N1029S probably damaging Het
Ftcd T G 10: 76,581,627 I300R probably damaging Het
Fxr1 T A 3: 34,047,029 Y161* probably null Het
Gabrg2 C T 11: 41,967,552 V250I probably benign Het
Gmcl1 T C 6: 86,721,402 D171G possibly damaging Het
Kat2b T A 17: 53,663,536 I650N probably damaging Het
Lhfp T C 3: 53,043,338 I11T probably benign Het
Mbtd1 A G 11: 93,910,350 Y141C probably damaging Het
Mon1b A T 8: 113,639,719 E449V probably damaging Het
Mrpl47 T C 3: 32,731,233 N112S probably damaging Het
Myo9a T A 9: 59,860,109 H865Q probably damaging Het
Notch3 T C 17: 32,132,336 N1895S probably damaging Het
Nuggc A G 14: 65,641,869 I693V probably benign Het
Oip5 A G 2: 119,615,629 S133P probably benign Het
Olfr1051 T C 2: 86,276,154 E111G probably damaging Het
Olfr1420 A T 19: 11,896,377 M119L probably damaging Het
Opcml A G 9: 28,675,270 I95V probably damaging Het
P2rx3 A C 2: 85,022,391 V221G probably damaging Het
Prr27 A G 5: 87,842,697 N56S possibly damaging Het
Psmd11 T C 11: 80,445,926 S135P possibly damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Sall3 T C 18: 80,973,528 D395G probably benign Het
Scube2 T C 7: 109,864,170 N62S probably benign Het
Sema6a A T 18: 47,290,115 S275T probably damaging Het
Sirpb1a A T 3: 15,379,044 L382Q possibly damaging Het
Snrpn T A 7: 59,986,885 probably null Het
Sox5 A T 6: 144,155,051 S71T possibly damaging Het
Synpo2l G T 14: 20,662,276 T321K probably benign Het
Tex15 G A 8: 33,565,205 E285K probably null Het
Tmem126b G A 7: 90,469,109 L188F probably damaging Het
Ttll2 T C 17: 7,351,368 T387A probably benign Het
Ttn A G 2: 76,836,811 Y11484H unknown Het
Vmn2r76 T A 7: 86,226,023 Y582F possibly damaging Het
Zfp786 A T 6: 47,820,795 L403Q possibly damaging Het
Other mutations in Olfr685
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01137:Olfr685 APN 7 105180488 missense probably benign 0.00
IGL01612:Olfr685 APN 7 105180722 missense probably damaging 1.00
IGL02598:Olfr685 APN 7 105180956 missense probably damaging 1.00
R0841:Olfr685 UTSW 7 105180854 missense probably damaging 0.96
R1164:Olfr685 UTSW 7 105180833 missense probably benign 0.02
R1711:Olfr685 UTSW 7 105180760 missense probably damaging 0.99
R1891:Olfr685 UTSW 7 105180547 nonsense probably null
R1901:Olfr685 UTSW 7 105180872 missense possibly damaging 0.88
R1990:Olfr685 UTSW 7 105181014 missense probably damaging 1.00
R3766:Olfr685 UTSW 7 105180881 missense probably damaging 0.98
R4750:Olfr685 UTSW 7 105180926 missense probably damaging 1.00
R5056:Olfr685 UTSW 7 105180572 missense probably damaging 1.00
R5061:Olfr685 UTSW 7 105180657 missense possibly damaging 0.56
R6227:Olfr685 UTSW 7 105180710 missense probably damaging 1.00
R7619:Olfr685 UTSW 7 105180749 missense probably damaging 1.00
R8075:Olfr685 UTSW 7 105181136 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGGTGTAAGGATGAATCAGTCC -3'
(R):5'- ACTCAGCCTGGTTCAGATATGTG -3'

Sequencing Primer
(F):5'- GTCCAGATAATGAAGATGATAGTCAC -3'
(R):5'- GGAAGACTCATCTGTAAACACTTGC -3'
Posted On2020-07-28