Incidental Mutation 'R8250:Mon1b'
ID640289
Institutional Source Beutler Lab
Gene Symbol Mon1b
Ensembl Gene ENSMUSG00000078908
Gene NameMON1 homolog B, secretory traffciking associated
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R8250 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location113635587-113645179 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 113639719 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 449 (E449V)
Ref Sequence ENSEMBL: ENSMUSP00000045089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034219] [ENSMUST00000035777] [ENSMUST00000095173] [ENSMUST00000179926] [ENSMUST00000212269]
Predicted Effect probably benign
Transcript: ENSMUST00000034219
SMART Domains Protein: ENSMUSP00000034219
Gene: ENSMUSG00000033409

DomainStartEndE-ValueType
Pfam:SYCE1 45 135 4.4e-39 PFAM
low complexity region 139 154 N/A INTRINSIC
low complexity region 196 212 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000035777
AA Change: E449V

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000045089
Gene: ENSMUSG00000078908
AA Change: E449V

DomainStartEndE-ValueType
Pfam:Mon1 105 533 5.5e-172 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000095173
SMART Domains Protein: ENSMUSP00000092796
Gene: ENSMUSG00000033409

DomainStartEndE-ValueType
Pfam:SYCE1 45 172 8.3e-47 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000179926
AA Change: E449V

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000137605
Gene: ENSMUSG00000078908
AA Change: E449V

DomainStartEndE-ValueType
Pfam:Mon1 110 532 3.3e-126 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212269
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,917,662 S515P probably damaging Het
Adamtsl1 A T 4: 86,342,609 E1027V probably damaging Het
Adrbk1 A G 19: 4,289,934 F375S probably damaging Het
Agbl2 G A 2: 90,797,564 G238R probably damaging Het
Ccdc27 A T 4: 154,041,788 D81E unknown Het
Csrnp3 A G 2: 66,022,218 E330G probably damaging Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Fat1 A G 8: 44,953,299 N1029S probably damaging Het
Ftcd T G 10: 76,581,627 I300R probably damaging Het
Fxr1 T A 3: 34,047,029 Y161* probably null Het
Gabrg2 C T 11: 41,967,552 V250I probably benign Het
Gmcl1 T C 6: 86,721,402 D171G possibly damaging Het
Kat2b T A 17: 53,663,536 I650N probably damaging Het
Lhfp T C 3: 53,043,338 I11T probably benign Het
Mbtd1 A G 11: 93,910,350 Y141C probably damaging Het
Mrpl47 T C 3: 32,731,233 N112S probably damaging Het
Myo9a T A 9: 59,860,109 H865Q probably damaging Het
Notch3 T C 17: 32,132,336 N1895S probably damaging Het
Nuggc A G 14: 65,641,869 I693V probably benign Het
Oip5 A G 2: 119,615,629 S133P probably benign Het
Olfr1051 T C 2: 86,276,154 E111G probably damaging Het
Olfr1420 A T 19: 11,896,377 M119L probably damaging Het
Olfr685 T C 7: 105,181,311 M16V Het
Opcml A G 9: 28,675,270 I95V probably damaging Het
P2rx3 A C 2: 85,022,391 V221G probably damaging Het
Prr27 A G 5: 87,842,697 N56S possibly damaging Het
Psmd11 T C 11: 80,445,926 S135P possibly damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Sall3 T C 18: 80,973,528 D395G probably benign Het
Scube2 T C 7: 109,864,170 N62S probably benign Het
Sema6a A T 18: 47,290,115 S275T probably damaging Het
Sirpb1a A T 3: 15,379,044 L382Q possibly damaging Het
Snrpn T A 7: 59,986,885 probably null Het
Sox5 A T 6: 144,155,051 S71T possibly damaging Het
Synpo2l G T 14: 20,662,276 T321K probably benign Het
Tex15 G A 8: 33,565,205 E285K probably null Het
Tmem126b G A 7: 90,469,109 L188F probably damaging Het
Ttll2 T C 17: 7,351,368 T387A probably benign Het
Ttn A G 2: 76,836,811 Y11484H unknown Het
Vmn2r76 T A 7: 86,226,023 Y582F possibly damaging Het
Zfp786 A T 6: 47,820,795 L403Q possibly damaging Het
Other mutations in Mon1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02487:Mon1b APN 8 113638823 missense possibly damaging 0.90
IGL02525:Mon1b APN 8 113638823 missense possibly damaging 0.90
IGL02526:Mon1b APN 8 113638823 missense possibly damaging 0.90
IGL02565:Mon1b APN 8 113638823 missense possibly damaging 0.90
IGL02577:Mon1b APN 8 113638823 missense possibly damaging 0.90
IGL02578:Mon1b APN 8 113638823 missense possibly damaging 0.90
IGL02579:Mon1b APN 8 113638823 missense possibly damaging 0.90
IGL02580:Mon1b APN 8 113638823 missense possibly damaging 0.90
IGL02667:Mon1b APN 8 113638823 missense possibly damaging 0.90
IGL02703:Mon1b APN 8 113638823 missense possibly damaging 0.90
PIT4651001:Mon1b UTSW 8 113638622 missense probably benign 0.33
R0326:Mon1b UTSW 8 113637743 missense probably benign 0.24
R0388:Mon1b UTSW 8 113639078 missense probably damaging 0.98
R1667:Mon1b UTSW 8 113641957 missense probably damaging 0.99
R2426:Mon1b UTSW 8 113639120 missense probably damaging 0.99
R3711:Mon1b UTSW 8 113639147 missense possibly damaging 0.76
R4896:Mon1b UTSW 8 113639227 missense probably damaging 0.97
R4912:Mon1b UTSW 8 113641953 nonsense probably null
R5004:Mon1b UTSW 8 113639227 missense probably damaging 0.97
R5243:Mon1b UTSW 8 113637921 missense possibly damaging 0.86
R5331:Mon1b UTSW 8 113636267 missense probably null 0.25
R6375:Mon1b UTSW 8 113638077 missense probably damaging 0.97
R6461:Mon1b UTSW 8 113638538 missense probably damaging 1.00
R6873:Mon1b UTSW 8 113642065 missense probably damaging 1.00
R8765:Mon1b UTSW 8 113636249 missense possibly damaging 0.72
Z1176:Mon1b UTSW 8 113637809 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGGCAGCTTGTCTTACAACCAC -3'
(R):5'- AAACCTGTGCACAGTCCAGC -3'

Sequencing Primer
(F):5'- CGAGATACCCTCAAGTCTAATGGG -3'
(R):5'- AGTCCAGCATGCCCATGGAG -3'
Posted On2020-07-28