Incidental Mutation 'R0095:Usp30'
ID64029
Institutional Source Beutler Lab
Gene Symbol Usp30
Ensembl Gene ENSMUSG00000029592
Gene Nameubiquitin specific peptidase 30
SynonymsD5Ertd483e, 6330590F17Rik
MMRRC Submission 038381-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0095 (G1)
Quality Score214
Status Not validated
Chromosome5
Chromosomal Location114065461-114124720 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 114105840 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 157 (F157I)
Ref Sequence ENSEMBL: ENSMUSP00000031588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031588] [ENSMUST00000200119] [ENSMUST00000202603]
Predicted Effect probably damaging
Transcript: ENSMUST00000031588
AA Change: F157I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031588
Gene: ENSMUSG00000029592
AA Change: F157I

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
transmembrane domain 35 57 N/A INTRINSIC
Pfam:UCH 67 499 2.6e-44 PFAM
Pfam:UCH_1 68 481 8.8e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196574
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197629
Predicted Effect probably damaging
Transcript: ENSMUST00000200119
AA Change: F157I

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000142350
Gene: ENSMUSG00000029592
AA Change: F157I

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
transmembrane domain 35 57 N/A INTRINSIC
Pfam:UCH 67 368 2.9e-31 PFAM
Pfam:UCH_1 68 376 1e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000202603
AA Change: F141I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144522
Gene: ENSMUSG00000029592
AA Change: F141I

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:UCH 51 144 5.8e-11 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] USP30, a member of the ubiquitin-specific protease family (see USP1, MIM 603478), is a novel mitochondrial deubiquitinating (DUB) enzyme (Nakamura and Hirose, 2008 [PubMed 18287522]).[supplied by OMIM, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anxa8 G A 14: 34,086,071 A6T probably benign Het
Bicc1 T A 10: 70,961,158 I42F probably damaging Het
Cutc T C 19: 43,753,199 W13R probably benign Het
F5 A T 1: 164,191,968 R671* probably null Het
Fam84b T C 15: 60,823,576 Y107C probably damaging Het
Fer A T 17: 63,941,326 E361V possibly damaging Het
Hnrnpa3 G T 2: 75,661,696 R52L probably damaging Het
Igsf10 A T 3: 59,331,196 Y521* probably null Het
Mmp1a G A 9: 7,465,620 G186D possibly damaging Het
Naip1 T C 13: 100,423,083 T1138A probably benign Het
Necab1 T A 4: 14,960,027 N307Y possibly damaging Het
Olfr510 A C 7: 108,668,045 I210L probably benign Het
Plekha5 T C 6: 140,528,597 F84L probably damaging Het
Rpl6 T G 5: 121,205,839 V115G possibly damaging Het
Sec16a A T 2: 26,425,760 probably null Het
Tpsg1 T C 17: 25,372,554 W43R probably damaging Het
Unc45a T C 7: 80,329,543 D567G probably damaging Het
Zfp345 T A 2: 150,472,300 H439L probably damaging Het
Other mutations in Usp30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03353:Usp30 APN 5 114121058 missense probably benign 0.00
IGL03384:Usp30 APN 5 114121574 missense probably damaging 1.00
R0972:Usp30 UTSW 5 114111864 splice site probably benign
R1184:Usp30 UTSW 5 114103827 critical splice donor site probably null
R1589:Usp30 UTSW 5 114112961 missense probably damaging 1.00
R1678:Usp30 UTSW 5 114121146 missense probably damaging 1.00
R2127:Usp30 UTSW 5 114111163 missense probably damaging 1.00
R2129:Usp30 UTSW 5 114111163 missense probably damaging 1.00
R2341:Usp30 UTSW 5 114111180 nonsense probably null
R4677:Usp30 UTSW 5 114119644 missense probably damaging 1.00
R5191:Usp30 UTSW 5 114065694 start gained probably benign
R5956:Usp30 UTSW 5 114119621 missense possibly damaging 0.89
R6730:Usp30 UTSW 5 114103709 missense probably damaging 1.00
R6947:Usp30 UTSW 5 114103760 missense probably benign 0.01
R7572:Usp30 UTSW 5 114120247 missense probably benign 0.15
R7653:Usp30 UTSW 5 114121669 missense probably damaging 1.00
R7654:Usp30 UTSW 5 114102445 missense probably damaging 1.00
R7794:Usp30 UTSW 5 114112972 nonsense probably null
R8063:Usp30 UTSW 5 114100463 missense probably benign 0.01
R8100:Usp30 UTSW 5 114111184 missense probably damaging 1.00
R8393:Usp30 UTSW 5 114121765 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACATGACTTGCTCACTCCGCAC -3'
(R):5'- GAAGCCAGCAGCTTTTCCCTTTG -3'

Sequencing Primer
(F):5'- CACTGTGTGAGGCTCCAAAG -3'
(R):5'- CTACCTACTGAGTGACAAGTGCTG -3'
Posted On2013-08-06