Incidental Mutation 'R8250:Gabrg2'
ID640293
Institutional Source Beutler Lab
Gene Symbol Gabrg2
Ensembl Gene ENSMUSG00000020436
Gene Namegamma-aminobutyric acid (GABA) A receptor, subunit gamma 2
Synonymsgamma2, Gabrg-2, GABAA-R
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R8250 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location41910203-42000857 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 41967552 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 250 (V250I)
Ref Sequence ENSEMBL: ENSMUSP00000063812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070725] [ENSMUST00000070735] [ENSMUST00000109290]
Predicted Effect probably benign
Transcript: ENSMUST00000070725
AA Change: V250I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000064739
Gene: ENSMUSG00000020436
AA Change: V250I

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
Pfam:Neur_chan_LBD 65 271 2.7e-55 PFAM
Pfam:Neur_chan_memb 278 408 1.8e-46 PFAM
transmembrane domain 442 464 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000070735
AA Change: V250I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000063812
Gene: ENSMUSG00000020436
AA Change: V250I

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
Pfam:Neur_chan_LBD 65 271 2.9e-53 PFAM
Pfam:Neur_chan_memb 278 419 2.2e-38 PFAM
transmembrane domain 450 472 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109290
AA Change: V250I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000104913
Gene: ENSMUSG00000020436
AA Change: V250I

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
Pfam:Neur_chan_LBD 65 271 1.2e-55 PFAM
Pfam:Neur_chan_memb 278 381 4.3e-44 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a gamma-aminobutyric acid (GABA)-A receptor subunit, which is a member of the ligand-gated ion channel family. GABA is the major inhibitory neurotransmitter in the adult central nervous system, and conversely exhibits an excitatory function during development. GABA-A receptors are pentameric, consisting of proteins from several subunit classes: alpha, beta, gamma, delta and rho. This gene encodes one of three gamma subunits in mammals, which contain the binding site for benzodiazepine drugs. Several mutations in this gene are associated with epileptic seizures, and genetic knockdown is associated with anxiety behavior. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit retarded postnatal growth, impaired sensorimotor function, and greatly reduced lifespan. Heterozygotes show enhanced anxiety-related behaviors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,917,662 S515P probably damaging Het
Adamtsl1 A T 4: 86,342,609 E1027V probably damaging Het
Adrbk1 A G 19: 4,289,934 F375S probably damaging Het
Agbl2 G A 2: 90,797,564 G238R probably damaging Het
Ccdc27 A T 4: 154,041,788 D81E unknown Het
Csrnp3 A G 2: 66,022,218 E330G probably damaging Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Fat1 A G 8: 44,953,299 N1029S probably damaging Het
Ftcd T G 10: 76,581,627 I300R probably damaging Het
Fxr1 T A 3: 34,047,029 Y161* probably null Het
Gmcl1 T C 6: 86,721,402 D171G possibly damaging Het
Kat2b T A 17: 53,663,536 I650N probably damaging Het
Lhfp T C 3: 53,043,338 I11T probably benign Het
Mbtd1 A G 11: 93,910,350 Y141C probably damaging Het
Mon1b A T 8: 113,639,719 E449V probably damaging Het
Mrpl47 T C 3: 32,731,233 N112S probably damaging Het
Myo9a T A 9: 59,860,109 H865Q probably damaging Het
Notch3 T C 17: 32,132,336 N1895S probably damaging Het
Nuggc A G 14: 65,641,869 I693V probably benign Het
Oip5 A G 2: 119,615,629 S133P probably benign Het
Olfr1051 T C 2: 86,276,154 E111G probably damaging Het
Olfr1420 A T 19: 11,896,377 M119L probably damaging Het
Olfr685 T C 7: 105,181,311 M16V Het
Opcml A G 9: 28,675,270 I95V probably damaging Het
P2rx3 A C 2: 85,022,391 V221G probably damaging Het
Prr27 A G 5: 87,842,697 N56S possibly damaging Het
Psmd11 T C 11: 80,445,926 S135P possibly damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Sall3 T C 18: 80,973,528 D395G probably benign Het
Scube2 T C 7: 109,864,170 N62S probably benign Het
Sema6a A T 18: 47,290,115 S275T probably damaging Het
Sirpb1a A T 3: 15,379,044 L382Q possibly damaging Het
Snrpn T A 7: 59,986,885 probably null Het
Sox5 A T 6: 144,155,051 S71T possibly damaging Het
Synpo2l G T 14: 20,662,276 T321K probably benign Het
Tex15 G A 8: 33,565,205 E285K probably null Het
Tmem126b G A 7: 90,469,109 L188F probably damaging Het
Ttll2 T C 17: 7,351,368 T387A probably benign Het
Ttn A G 2: 76,836,811 Y11484H unknown Het
Vmn2r76 T A 7: 86,226,023 Y582F possibly damaging Het
Zfp786 A T 6: 47,820,795 L403Q possibly damaging Het
Other mutations in Gabrg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00640:Gabrg2 APN 11 41971772 missense possibly damaging 0.87
IGL00787:Gabrg2 APN 11 41912522 missense probably benign 0.00
IGL01941:Gabrg2 APN 11 41971721 missense probably damaging 1.00
IGL02801:Gabrg2 APN 11 41912393 missense probably damaging 1.00
R0376:Gabrg2 UTSW 11 41916315 missense possibly damaging 0.92
R1607:Gabrg2 UTSW 11 41976663 missense probably damaging 0.98
R1934:Gabrg2 UTSW 11 41920470 missense probably benign 0.10
R2226:Gabrg2 UTSW 11 41971908 missense probably damaging 1.00
R2281:Gabrg2 UTSW 11 41976636 missense possibly damaging 0.72
R4013:Gabrg2 UTSW 11 41971880 missense possibly damaging 0.83
R4675:Gabrg2 UTSW 11 41968823 missense probably damaging 1.00
R4869:Gabrg2 UTSW 11 41920404 missense probably damaging 1.00
R5282:Gabrg2 UTSW 11 41971732 missense probably damaging 1.00
R5316:Gabrg2 UTSW 11 41976558 missense probably damaging 1.00
R5729:Gabrg2 UTSW 11 41967623 missense probably damaging 1.00
R5876:Gabrg2 UTSW 11 41968820 missense probably damaging 1.00
R6279:Gabrg2 UTSW 11 42000523 splice site probably null
R6300:Gabrg2 UTSW 11 42000523 splice site probably null
R6315:Gabrg2 UTSW 11 41971861 missense probably damaging 0.99
R7181:Gabrg2 UTSW 11 41920434 missense probably damaging 1.00
R7182:Gabrg2 UTSW 11 41920506 missense probably damaging 0.98
R7368:Gabrg2 UTSW 11 41976563 nonsense probably null
R7568:Gabrg2 UTSW 11 41916292 missense probably benign 0.05
R7599:Gabrg2 UTSW 11 41967624 missense possibly damaging 0.79
R7901:Gabrg2 UTSW 11 41976591 missense probably benign 0.00
R7940:Gabrg2 UTSW 11 41967647 missense probably benign 0.06
X0065:Gabrg2 UTSW 11 41912369 missense probably damaging 1.00
Z1191:Gabrg2 UTSW 11 41916277 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTCTGCAACTAGAATACCAGC -3'
(R):5'- GAGGCAAATTCCACAAGGC -3'

Sequencing Primer
(F):5'- ACTAGAATACCAGCTATCATTTTGTC -3'
(R):5'- AGTCCAGTGTGCTCATATGAC -3'
Posted On2020-07-28