Incidental Mutation 'R8250:Psmd11'
ID640294
Institutional Source Beutler Lab
Gene Symbol Psmd11
Ensembl Gene ENSMUSG00000017428
Gene Nameproteasome (prosome, macropain) 26S subunit, non-ATPase, 11
Synonyms1700089D09Rik, 2810055C24Rik, P44.5, C78232, 2610024G20Rik, S9, 1810019E17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R8250 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location80428615-80473248 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80445926 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 135 (S135P)
Ref Sequence ENSEMBL: ENSMUSP00000017572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017572] [ENSMUST00000172615] [ENSMUST00000172773] [ENSMUST00000172847] [ENSMUST00000173186] [ENSMUST00000173565] [ENSMUST00000173938] [ENSMUST00000174743]
Predicted Effect possibly damaging
Transcript: ENSMUST00000017572
AA Change: S135P

PolyPhen 2 Score 0.676 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000017572
Gene: ENSMUSG00000017428
AA Change: S135P

DomainStartEndE-ValueType
PAM 143 320 1.6e-67 SMART
PINT 321 404 4.34e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172615
SMART Domains Protein: ENSMUSP00000134129
Gene: ENSMUSG00000017428

DomainStartEndE-ValueType
PDB:3TXN|A 37 106 1e-22 PDB
Blast:PAM 83 106 2e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000172773
SMART Domains Protein: ENSMUSP00000134096
Gene: ENSMUSG00000017428

DomainStartEndE-ValueType
PDB:3TXN|A 37 110 7e-24 PDB
Blast:PAM 83 110 1e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000172847
SMART Domains Protein: ENSMUSP00000134136
Gene: ENSMUSG00000017428

DomainStartEndE-ValueType
PDB:3TXN|A 30 99 2e-22 PDB
Blast:PAM 76 99 1e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173060
SMART Domains Protein: ENSMUSP00000133509
Gene: ENSMUSG00000017428

DomainStartEndE-ValueType
PDB:3TXN|A 29 98 2e-22 PDB
Blast:PAM 75 98 1e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173186
Predicted Effect possibly damaging
Transcript: ENSMUST00000173565
AA Change: S37P

PolyPhen 2 Score 0.676 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000134326
Gene: ENSMUSG00000017428
AA Change: S37P

DomainStartEndE-ValueType
PDB:3TXN|A 1 114 2e-50 PDB
Blast:PAM 45 114 3e-31 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000173938
AA Change: S135P

PolyPhen 2 Score 0.676 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000133571
Gene: ENSMUSG00000017428
AA Change: S135P

DomainStartEndE-ValueType
PAM 143 320 1.6e-67 SMART
PINT 321 404 4.34e-23 SMART
Predicted Effect unknown
Transcript: ENSMUST00000174743
AA Change: V86A
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. This gene encodes a member of the proteasome subunit S9 family that functions as a non-ATPase subunit of the 19S regulator and is phosphorylated by AMP-activated protein kinase. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,917,662 S515P probably damaging Het
Adamtsl1 A T 4: 86,342,609 E1027V probably damaging Het
Adrbk1 A G 19: 4,289,934 F375S probably damaging Het
Agbl2 G A 2: 90,797,564 G238R probably damaging Het
Ccdc27 A T 4: 154,041,788 D81E unknown Het
Csrnp3 A G 2: 66,022,218 E330G probably damaging Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Fat1 A G 8: 44,953,299 N1029S probably damaging Het
Ftcd T G 10: 76,581,627 I300R probably damaging Het
Fxr1 T A 3: 34,047,029 Y161* probably null Het
Gabrg2 C T 11: 41,967,552 V250I probably benign Het
Gmcl1 T C 6: 86,721,402 D171G possibly damaging Het
Kat2b T A 17: 53,663,536 I650N probably damaging Het
Lhfp T C 3: 53,043,338 I11T probably benign Het
Mbtd1 A G 11: 93,910,350 Y141C probably damaging Het
Mon1b A T 8: 113,639,719 E449V probably damaging Het
Mrpl47 T C 3: 32,731,233 N112S probably damaging Het
Myo9a T A 9: 59,860,109 H865Q probably damaging Het
Notch3 T C 17: 32,132,336 N1895S probably damaging Het
Nuggc A G 14: 65,641,869 I693V probably benign Het
Oip5 A G 2: 119,615,629 S133P probably benign Het
Olfr1051 T C 2: 86,276,154 E111G probably damaging Het
Olfr1420 A T 19: 11,896,377 M119L probably damaging Het
Olfr685 T C 7: 105,181,311 M16V Het
Opcml A G 9: 28,675,270 I95V probably damaging Het
P2rx3 A C 2: 85,022,391 V221G probably damaging Het
Prr27 A G 5: 87,842,697 N56S possibly damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Sall3 T C 18: 80,973,528 D395G probably benign Het
Scube2 T C 7: 109,864,170 N62S probably benign Het
Sema6a A T 18: 47,290,115 S275T probably damaging Het
Sirpb1a A T 3: 15,379,044 L382Q possibly damaging Het
Snrpn T A 7: 59,986,885 probably null Het
Sox5 A T 6: 144,155,051 S71T possibly damaging Het
Synpo2l G T 14: 20,662,276 T321K probably benign Het
Tex15 G A 8: 33,565,205 E285K probably null Het
Tmem126b G A 7: 90,469,109 L188F probably damaging Het
Ttll2 T C 17: 7,351,368 T387A probably benign Het
Ttn A G 2: 76,836,811 Y11484H unknown Het
Vmn2r76 T A 7: 86,226,023 Y582F possibly damaging Het
Zfp786 A T 6: 47,820,795 L403Q possibly damaging Het
Other mutations in Psmd11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Psmd11 APN 11 80470384 missense possibly damaging 0.88
IGL03383:Psmd11 APN 11 80469845 missense probably damaging 1.00
R0358:Psmd11 UTSW 11 80462684 splice site probably benign
R0529:Psmd11 UTSW 11 80470689 unclassified probably benign
R1127:Psmd11 UTSW 11 80471584 missense possibly damaging 0.89
R1936:Psmd11 UTSW 11 80428744 missense probably damaging 1.00
R1985:Psmd11 UTSW 11 80445263 missense probably damaging 1.00
R2356:Psmd11 UTSW 11 80428704 missense possibly damaging 0.89
R2994:Psmd11 UTSW 11 80460667 missense probably damaging 1.00
R4898:Psmd11 UTSW 11 80438320 missense probably damaging 1.00
R5173:Psmd11 UTSW 11 80460740 missense probably benign 0.01
R5234:Psmd11 UTSW 11 80428740 missense probably benign 0.05
R5794:Psmd11 UTSW 11 80471492 missense probably benign 0.00
R6169:Psmd11 UTSW 11 80460713 missense probably damaging 1.00
R6266:Psmd11 UTSW 11 80445941 missense probably benign 0.01
R6275:Psmd11 UTSW 11 80438632 intron probably benign
R7121:Psmd11 UTSW 11 80438273 nonsense probably null
R7318:Psmd11 UTSW 11 80456302 missense probably benign 0.29
R7769:Psmd11 UTSW 11 80434582 intron probably benign
Z1088:Psmd11 UTSW 11 80471550 frame shift probably null
Z1176:Psmd11 UTSW 11 80428648 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GAAATAGTACTGGGGCTGAGTTC -3'
(R):5'- TCTAAAGCAGGACTTTACCGTG -3'

Sequencing Primer
(F):5'- AATAGTACTGGGGCTGAGTTCAGTTG -3'
(R):5'- GGAATCCACTCATTTGGC -3'
Posted On2020-07-28