Incidental Mutation 'R8250:Dcp1a'
ID640297
Institutional Source Beutler Lab
Gene Symbol Dcp1a
Ensembl Gene ENSMUSG00000021962
Gene Namedecapping mRNA 1A
Synonyms1110066A22Rik, Mitc1, 4930568L04Rik, SMIF, D14Ertd817e
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.258) question?
Stock #R8250 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location30479535-30527063 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30522926 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 570 (T570A)
Ref Sequence ENSEMBL: ENSMUSP00000022535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022535] [ENSMUST00000225196] [ENSMUST00000225286]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022535
AA Change: T570A

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000022535
Gene: ENSMUSG00000021962
AA Change: T570A

DomainStartEndE-ValueType
Pfam:DCP1 28 144 1.8e-44 PFAM
low complexity region 327 343 N/A INTRINSIC
low complexity region 457 472 N/A INTRINSIC
Pfam:mRNA_decap_C 559 601 6.3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223658
Predicted Effect possibly damaging
Transcript: ENSMUST00000225196
AA Change: T570A

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000225286
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Decapping is a key step in general and regulated mRNA decay. The protein encoded by this gene is a decapping enzyme. This protein and another decapping enzyme form a decapping complex, which interacts with the nonsense-mediated decay factor hUpf1 and may be recruited to mRNAs containing premature termination codons. This protein also participates in the TGF-beta signaling pathway. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,917,662 S515P probably damaging Het
Adamtsl1 A T 4: 86,342,609 E1027V probably damaging Het
Adrbk1 A G 19: 4,289,934 F375S probably damaging Het
Agbl2 G A 2: 90,797,564 G238R probably damaging Het
Ccdc27 A T 4: 154,041,788 D81E unknown Het
Csrnp3 A G 2: 66,022,218 E330G probably damaging Het
Fat1 A G 8: 44,953,299 N1029S probably damaging Het
Ftcd T G 10: 76,581,627 I300R probably damaging Het
Fxr1 T A 3: 34,047,029 Y161* probably null Het
Gabrg2 C T 11: 41,967,552 V250I probably benign Het
Gmcl1 T C 6: 86,721,402 D171G possibly damaging Het
Kat2b T A 17: 53,663,536 I650N probably damaging Het
Lhfp T C 3: 53,043,338 I11T probably benign Het
Mbtd1 A G 11: 93,910,350 Y141C probably damaging Het
Mon1b A T 8: 113,639,719 E449V probably damaging Het
Mrpl47 T C 3: 32,731,233 N112S probably damaging Het
Myo9a T A 9: 59,860,109 H865Q probably damaging Het
Notch3 T C 17: 32,132,336 N1895S probably damaging Het
Nuggc A G 14: 65,641,869 I693V probably benign Het
Oip5 A G 2: 119,615,629 S133P probably benign Het
Olfr1051 T C 2: 86,276,154 E111G probably damaging Het
Olfr1420 A T 19: 11,896,377 M119L probably damaging Het
Olfr685 T C 7: 105,181,311 M16V Het
Opcml A G 9: 28,675,270 I95V probably damaging Het
P2rx3 A C 2: 85,022,391 V221G probably damaging Het
Prr27 A G 5: 87,842,697 N56S possibly damaging Het
Psmd11 T C 11: 80,445,926 S135P possibly damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Sall3 T C 18: 80,973,528 D395G probably benign Het
Scube2 T C 7: 109,864,170 N62S probably benign Het
Sema6a A T 18: 47,290,115 S275T probably damaging Het
Sirpb1a A T 3: 15,379,044 L382Q possibly damaging Het
Snrpn T A 7: 59,986,885 probably null Het
Sox5 A T 6: 144,155,051 S71T possibly damaging Het
Synpo2l G T 14: 20,662,276 T321K probably benign Het
Tex15 G A 8: 33,565,205 E285K probably null Het
Tmem126b G A 7: 90,469,109 L188F probably damaging Het
Ttll2 T C 17: 7,351,368 T387A probably benign Het
Ttn A G 2: 76,836,811 Y11484H unknown Het
Vmn2r76 T A 7: 86,226,023 Y582F possibly damaging Het
Zfp786 A T 6: 47,820,795 L403Q possibly damaging Het
Other mutations in Dcp1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01653:Dcp1a APN 14 30505571 missense possibly damaging 0.52
IGL02698:Dcp1a APN 14 30505542 splice site probably benign
IGL02799:Dcp1a UTSW 14 30519679 critical splice donor site probably null
R0240:Dcp1a UTSW 14 30484594 splice site probably benign
R0387:Dcp1a UTSW 14 30519679 critical splice donor site probably null
R0646:Dcp1a UTSW 14 30502885 missense probably damaging 1.00
R1781:Dcp1a UTSW 14 30513075 missense probably benign 0.37
R1843:Dcp1a UTSW 14 30518983 missense probably damaging 0.99
R2111:Dcp1a UTSW 14 30519370 missense probably benign 0.00
R3176:Dcp1a UTSW 14 30505542 splice site probably benign
R4948:Dcp1a UTSW 14 30479767 missense probably damaging 1.00
R5541:Dcp1a UTSW 14 30502839 missense probably damaging 1.00
R6178:Dcp1a UTSW 14 30523304 makesense probably null
R7767:Dcp1a UTSW 14 30479818 critical splice donor site probably null
R7818:Dcp1a UTSW 14 30479721 missense probably damaging 0.99
R8248:Dcp1a UTSW 14 30479598 intron probably benign
R8248:Dcp1a UTSW 14 30522926 missense possibly damaging 0.87
R8271:Dcp1a UTSW 14 30522926 missense possibly damaging 0.87
R8297:Dcp1a UTSW 14 30522926 missense possibly damaging 0.87
R8302:Dcp1a UTSW 14 30522926 missense possibly damaging 0.87
R8326:Dcp1a UTSW 14 30519570 nonsense probably null
R8333:Dcp1a UTSW 14 30522926 missense possibly damaging 0.87
R8818:Dcp1a UTSW 14 30518942 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- TATTCTGTGTCCCGGCAGATTG -3'
(R):5'- CAGAGGCAGTTACAATGACAGTC -3'

Sequencing Primer
(F):5'- CAGATTGCAGGCTCTCCATTGG -3'
(R):5'- TGACAGTCCAGGTTTACAGC -3'
Posted On2020-07-28