Incidental Mutation 'R0095:Rpl6'
ID64030
Institutional Source Beutler Lab
Gene Symbol Rpl6
Ensembl Gene ENSMUSG00000029614
Gene Nameribosomal protein L6
SynonymsTaxreb107
MMRRC Submission 038381-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R0095 (G1)
Quality Score115
Status Not validated
Chromosome5
Chromosomal Location121204481-121209241 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 121205839 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 115 (V115G)
Ref Sequence ENSEMBL: ENSMUSP00000031617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031617] [ENSMUST00000201155]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031617
AA Change: V115G

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000031617
Gene: ENSMUSG00000029614
AA Change: V115G

DomainStartEndE-ValueType
Pfam:Ribosomal_L6e_N 43 103 4.5e-36 PFAM
Pfam:Ribosomal_L6e 189 296 2.7e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082907
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124330
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138621
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139177
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140515
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146579
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197044
Predicted Effect probably benign
Transcript: ENSMUST00000201155
SMART Domains Protein: ENSMUSP00000143981
Gene: ENSMUSG00000029614

DomainStartEndE-ValueType
Blast:Zn_pept 1 33 7e-11 BLAST
PDB:3J39|E 2 45 3e-13 PDB
Meta Mutation Damage Score 0.6315 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anxa8 G A 14: 34,086,071 A6T probably benign Het
Bicc1 T A 10: 70,961,158 I42F probably damaging Het
Cutc T C 19: 43,753,199 W13R probably benign Het
F5 A T 1: 164,191,968 R671* probably null Het
Fam84b T C 15: 60,823,576 Y107C probably damaging Het
Fer A T 17: 63,941,326 E361V possibly damaging Het
Hnrnpa3 G T 2: 75,661,696 R52L probably damaging Het
Igsf10 A T 3: 59,331,196 Y521* probably null Het
Mmp1a G A 9: 7,465,620 G186D possibly damaging Het
Naip1 T C 13: 100,423,083 T1138A probably benign Het
Necab1 T A 4: 14,960,027 N307Y possibly damaging Het
Olfr510 A C 7: 108,668,045 I210L probably benign Het
Plekha5 T C 6: 140,528,597 F84L probably damaging Het
Sec16a A T 2: 26,425,760 probably null Het
Tpsg1 T C 17: 25,372,554 W43R probably damaging Het
Unc45a T C 7: 80,329,543 D567G probably damaging Het
Usp30 T A 5: 114,105,840 F157I probably damaging Het
Zfp345 T A 2: 150,472,300 H439L probably damaging Het
Other mutations in Rpl6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02819:Rpl6 APN 5 121207201 splice site probably benign
R0095:Rpl6 UTSW 5 121205839 missense possibly damaging 0.62
R0197:Rpl6 UTSW 5 121208478 missense probably benign 0.18
R0346:Rpl6 UTSW 5 121208491 missense possibly damaging 0.52
R0883:Rpl6 UTSW 5 121208478 missense probably benign 0.18
R0972:Rpl6 UTSW 5 121208502 missense possibly damaging 0.75
R6005:Rpl6 UTSW 5 121205514 unclassified probably benign
R6278:Rpl6 UTSW 5 121208849 missense possibly damaging 0.94
R7021:Rpl6 UTSW 5 121208909 missense probably benign 0.35
R7426:Rpl6 UTSW 5 121205592 missense possibly damaging 0.69
R7488:Rpl6 UTSW 5 121208528 missense probably benign 0.01
Z1177:Rpl6 UTSW 5 121206797 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AACGGATGGCCCACTATGATGC -3'
(R):5'- TACCTTGGCAGAAGGCACACAC -3'

Sequencing Primer
(F):5'- ATGGCCCACTATGATGCCTTATTC -3'
(R):5'- CTTTCTTCAAGAGGGAAAACTAGAC -3'
Posted On2013-08-06