Incidental Mutation 'R8250:Rftn1'
ID640301
Institutional Source Beutler Lab
Gene Symbol Rftn1
Ensembl Gene ENSMUSG00000039316
Gene Nameraftlin lipid raft linker 1
Synonyms2310015N21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R8250 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location49992257-50190674 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 50047380 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 318 (A318D)
Ref Sequence ENSEMBL: ENSMUSP00000046524 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044503] [ENSMUST00000113195]
Predicted Effect probably damaging
Transcript: ENSMUST00000044503
AA Change: A318D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046524
Gene: ENSMUSG00000039316
AA Change: A318D

DomainStartEndE-ValueType
Pfam:Raftlin 1 473 1.3e-219 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113195
AA Change: A40D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108820
Gene: ENSMUSG00000039316
AA Change: A40D

DomainStartEndE-ValueType
Pfam:Raftlin 1 207 1.5e-104 PFAM
Meta Mutation Damage Score 0.3897 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for null mutations have defects in T cell activation, T cell help to B cells, and Th17 differentation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,917,662 S515P probably damaging Het
Adamtsl1 A T 4: 86,342,609 E1027V probably damaging Het
Adrbk1 A G 19: 4,289,934 F375S probably damaging Het
Agbl2 G A 2: 90,797,564 G238R probably damaging Het
Ccdc27 A T 4: 154,041,788 D81E unknown Het
Csrnp3 A G 2: 66,022,218 E330G probably damaging Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Fat1 A G 8: 44,953,299 N1029S probably damaging Het
Ftcd T G 10: 76,581,627 I300R probably damaging Het
Fxr1 T A 3: 34,047,029 Y161* probably null Het
Gabrg2 C T 11: 41,967,552 V250I probably benign Het
Gmcl1 T C 6: 86,721,402 D171G possibly damaging Het
Kat2b T A 17: 53,663,536 I650N probably damaging Het
Lhfp T C 3: 53,043,338 I11T probably benign Het
Mbtd1 A G 11: 93,910,350 Y141C probably damaging Het
Mon1b A T 8: 113,639,719 E449V probably damaging Het
Mrpl47 T C 3: 32,731,233 N112S probably damaging Het
Myo9a T A 9: 59,860,109 H865Q probably damaging Het
Notch3 T C 17: 32,132,336 N1895S probably damaging Het
Nuggc A G 14: 65,641,869 I693V probably benign Het
Oip5 A G 2: 119,615,629 S133P probably benign Het
Olfr1051 T C 2: 86,276,154 E111G probably damaging Het
Olfr1420 A T 19: 11,896,377 M119L probably damaging Het
Olfr685 T C 7: 105,181,311 M16V Het
Opcml A G 9: 28,675,270 I95V probably damaging Het
P2rx3 A C 2: 85,022,391 V221G probably damaging Het
Prr27 A G 5: 87,842,697 N56S possibly damaging Het
Psmd11 T C 11: 80,445,926 S135P possibly damaging Het
Sall3 T C 18: 80,973,528 D395G probably benign Het
Scube2 T C 7: 109,864,170 N62S probably benign Het
Sema6a A T 18: 47,290,115 S275T probably damaging Het
Sirpb1a A T 3: 15,379,044 L382Q possibly damaging Het
Snrpn T A 7: 59,986,885 probably null Het
Sox5 A T 6: 144,155,051 S71T possibly damaging Het
Synpo2l G T 14: 20,662,276 T321K probably benign Het
Tex15 G A 8: 33,565,205 E285K probably null Het
Tmem126b G A 7: 90,469,109 L188F probably damaging Het
Ttll2 T C 17: 7,351,368 T387A probably benign Het
Ttn A G 2: 76,836,811 Y11484H unknown Het
Vmn2r76 T A 7: 86,226,023 Y582F possibly damaging Het
Zfp786 A T 6: 47,820,795 L403Q possibly damaging Het
Other mutations in Rftn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Rftn1 APN 17 50055377 missense probably benign 0.01
IGL02318:Rftn1 APN 17 50036970 missense possibly damaging 0.95
IGL02568:Rftn1 APN 17 50036999 missense probably damaging 1.00
IGL02873:Rftn1 APN 17 50169152 utr 5 prime probably benign
IGL02965:Rftn1 APN 17 50055252 missense probably benign 0.32
BB001:Rftn1 UTSW 17 50047380 missense probably damaging 1.00
BB003:Rftn1 UTSW 17 50047380 missense probably damaging 1.00
BB004:Rftn1 UTSW 17 50047380 missense probably damaging 1.00
BB005:Rftn1 UTSW 17 50047380 missense probably damaging 1.00
BB011:Rftn1 UTSW 17 50047380 missense probably damaging 1.00
BB013:Rftn1 UTSW 17 50047380 missense probably damaging 1.00
BB014:Rftn1 UTSW 17 50047380 missense probably damaging 1.00
BB015:Rftn1 UTSW 17 50047380 missense probably damaging 1.00
R0544:Rftn1 UTSW 17 49994261 missense possibly damaging 0.71
R2219:Rftn1 UTSW 17 50169145 start codon destroyed probably null 1.00
R4542:Rftn1 UTSW 17 50055231 splice site probably null
R5318:Rftn1 UTSW 17 49994458 missense probably benign 0.09
R5605:Rftn1 UTSW 17 50047407 missense probably damaging 1.00
R5700:Rftn1 UTSW 17 50002669 missense probably damaging 1.00
R5853:Rftn1 UTSW 17 50047326 missense probably damaging 1.00
R6459:Rftn1 UTSW 17 50047306 missense probably benign 0.02
R6994:Rftn1 UTSW 17 50036991 missense possibly damaging 0.82
R7210:Rftn1 UTSW 17 49994307 nonsense probably null
R7283:Rftn1 UTSW 17 50047441 missense probably damaging 1.00
R7348:Rftn1 UTSW 17 50004323 missense probably damaging 1.00
R7444:Rftn1 UTSW 17 50047407 missense probably damaging 1.00
R7684:Rftn1 UTSW 17 50047380 missense probably damaging 1.00
R7685:Rftn1 UTSW 17 50047380 missense probably damaging 1.00
R7686:Rftn1 UTSW 17 50047380 missense probably damaging 1.00
R7881:Rftn1 UTSW 17 50047435 missense probably benign 0.08
R7924:Rftn1 UTSW 17 50047380 missense probably damaging 1.00
R7926:Rftn1 UTSW 17 50047380 missense probably damaging 1.00
R7927:Rftn1 UTSW 17 50047380 missense probably damaging 1.00
R7928:Rftn1 UTSW 17 50047380 missense probably damaging 1.00
R7943:Rftn1 UTSW 17 50047380 missense probably damaging 1.00
R8052:Rftn1 UTSW 17 50086579 missense probably damaging 0.98
R8162:Rftn1 UTSW 17 50047380 missense probably damaging 1.00
R8164:Rftn1 UTSW 17 50047380 missense probably damaging 1.00
R8248:Rftn1 UTSW 17 50047380 missense probably damaging 1.00
R8249:Rftn1 UTSW 17 50047380 missense probably damaging 1.00
R8271:Rftn1 UTSW 17 50047380 missense probably damaging 1.00
R8272:Rftn1 UTSW 17 50047380 missense probably damaging 1.00
R8273:Rftn1 UTSW 17 50047380 missense probably damaging 1.00
R8296:Rftn1 UTSW 17 50047380 missense probably damaging 1.00
R8297:Rftn1 UTSW 17 50047380 missense probably damaging 1.00
R8300:Rftn1 UTSW 17 50047380 missense probably damaging 1.00
R8315:Rftn1 UTSW 17 50002637 missense possibly damaging 0.50
R8551:Rftn1 UTSW 17 50047380 missense probably damaging 1.00
R8552:Rftn1 UTSW 17 50047380 missense probably damaging 1.00
R8554:Rftn1 UTSW 17 50047380 missense probably damaging 1.00
R8555:Rftn1 UTSW 17 50047380 missense probably damaging 1.00
R8725:Rftn1 UTSW 17 50047380 missense probably damaging 1.00
R8736:Rftn1 UTSW 17 50047380 missense probably damaging 1.00
R8739:Rftn1 UTSW 17 50047380 missense probably damaging 1.00
Z1176:Rftn1 UTSW 17 50169003 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGCCTTTGTGAGATCTGCCC -3'
(R):5'- CAAATTGGTTCTGTGGGCTAAC -3'

Sequencing Primer
(F):5'- TGAGATCTGCCCAAGCTATG -3'
(R):5'- AATTGGTTCTGTGGGCTAACCTCTC -3'
Posted On2020-07-28