Incidental Mutation 'R8250:Sall3'
ID640304
Institutional Source Beutler Lab
Gene Symbol Sall3
Ensembl Gene ENSMUSG00000024565
Gene Namespalt like transcription factor 3
SynonymsMsal, Spalt, Msal-1, Salt, B130022O04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8250 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location80966376-80986578 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80973528 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 395 (D395G)
Ref Sequence ENSEMBL: ENSMUSP00000056967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057950]
Predicted Effect probably benign
Transcript: ENSMUST00000057950
AA Change: D395G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000056967
Gene: ENSMUSG00000024565
AA Change: D395G

DomainStartEndE-ValueType
low complexity region 34 51 N/A INTRINSIC
low complexity region 143 161 N/A INTRINSIC
low complexity region 189 206 N/A INTRINSIC
low complexity region 210 231 N/A INTRINSIC
low complexity region 271 289 N/A INTRINSIC
low complexity region 323 342 N/A INTRINSIC
low complexity region 350 371 N/A INTRINSIC
ZnF_C2H2 427 449 2.57e-3 SMART
ZnF_C2H2 455 477 3.21e-4 SMART
low complexity region 555 568 N/A INTRINSIC
ZnF_C2H2 692 714 3.99e0 SMART
ZnF_C2H2 720 742 2.99e-4 SMART
ZnF_C2H2 752 774 1.6e-4 SMART
low complexity region 834 852 N/A INTRINSIC
low complexity region 901 923 N/A INTRINSIC
low complexity region 993 1007 N/A INTRINSIC
ZnF_C2H2 1061 1083 1.69e-3 SMART
ZnF_C2H2 1089 1111 5.99e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sal-like C2H2-type zinc-finger protein, and belongs to a family of evolutionarily conserved genes found in species as diverse as Drosophila, C. elegans, and vertebrates. Mutations in some of these genes are associated with congenital disorders in human, suggesting their importance in embryonic development. This protein binds to DNA methyltransferase 3 alpha (DNMT3A), and reduces DNMT3A-mediated CpG island methylation. It is suggested that silencing of this gene, resulting in acceleration of DNA methylation, may have a role in oncogenesis. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display neonatal lethality with an impaired suckling ability, truncated soft palate, small epiglottis, and abnormal cranial nerve morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,917,662 S515P probably damaging Het
Adamtsl1 A T 4: 86,342,609 E1027V probably damaging Het
Adrbk1 A G 19: 4,289,934 F375S probably damaging Het
Agbl2 G A 2: 90,797,564 G238R probably damaging Het
Ccdc27 A T 4: 154,041,788 D81E unknown Het
Csrnp3 A G 2: 66,022,218 E330G probably damaging Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Fat1 A G 8: 44,953,299 N1029S probably damaging Het
Ftcd T G 10: 76,581,627 I300R probably damaging Het
Fxr1 T A 3: 34,047,029 Y161* probably null Het
Gabrg2 C T 11: 41,967,552 V250I probably benign Het
Gmcl1 T C 6: 86,721,402 D171G possibly damaging Het
Kat2b T A 17: 53,663,536 I650N probably damaging Het
Lhfp T C 3: 53,043,338 I11T probably benign Het
Mbtd1 A G 11: 93,910,350 Y141C probably damaging Het
Mon1b A T 8: 113,639,719 E449V probably damaging Het
Mrpl47 T C 3: 32,731,233 N112S probably damaging Het
Myo9a T A 9: 59,860,109 H865Q probably damaging Het
Notch3 T C 17: 32,132,336 N1895S probably damaging Het
Nuggc A G 14: 65,641,869 I693V probably benign Het
Oip5 A G 2: 119,615,629 S133P probably benign Het
Olfr1051 T C 2: 86,276,154 E111G probably damaging Het
Olfr1420 A T 19: 11,896,377 M119L probably damaging Het
Olfr685 T C 7: 105,181,311 M16V Het
Opcml A G 9: 28,675,270 I95V probably damaging Het
P2rx3 A C 2: 85,022,391 V221G probably damaging Het
Prr27 A G 5: 87,842,697 N56S possibly damaging Het
Psmd11 T C 11: 80,445,926 S135P possibly damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Scube2 T C 7: 109,864,170 N62S probably benign Het
Sema6a A T 18: 47,290,115 S275T probably damaging Het
Sirpb1a A T 3: 15,379,044 L382Q possibly damaging Het
Snrpn T A 7: 59,986,885 probably null Het
Sox5 A T 6: 144,155,051 S71T possibly damaging Het
Synpo2l G T 14: 20,662,276 T321K probably benign Het
Tex15 G A 8: 33,565,205 E285K probably null Het
Tmem126b G A 7: 90,469,109 L188F probably damaging Het
Ttll2 T C 17: 7,351,368 T387A probably benign Het
Ttn A G 2: 76,836,811 Y11484H unknown Het
Vmn2r76 T A 7: 86,226,023 Y582F possibly damaging Het
Zfp786 A T 6: 47,820,795 L403Q possibly damaging Het
Other mutations in Sall3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Sall3 APN 18 80973232 missense probably damaging 0.98
IGL01630:Sall3 APN 18 80971269 missense probably benign 0.03
IGL01713:Sall3 APN 18 80969847 missense probably damaging 1.00
IGL01803:Sall3 APN 18 80969832 missense possibly damaging 0.65
IGL02627:Sall3 APN 18 80972361 missense possibly damaging 0.86
IGL02858:Sall3 APN 18 80969513 missense probably damaging 1.00
IGL03177:Sall3 APN 18 80972968 missense probably benign 0.00
fountain UTSW 18 80974476 missense probably damaging 0.99
IGL02984:Sall3 UTSW 18 80973450 missense probably benign 0.01
R1055:Sall3 UTSW 18 80969792 missense probably benign 0.24
R1258:Sall3 UTSW 18 80974065 missense probably damaging 1.00
R1932:Sall3 UTSW 18 80969753 missense probably benign 0.44
R1976:Sall3 UTSW 18 80971893 missense probably benign 0.42
R2124:Sall3 UTSW 18 80971797 missense probably benign 0.01
R2142:Sall3 UTSW 18 80969831 missense probably damaging 0.98
R2199:Sall3 UTSW 18 80971870 missense probably benign 0.27
R2365:Sall3 UTSW 18 80971792 missense probably benign 0.01
R3856:Sall3 UTSW 18 80972502 missense probably damaging 1.00
R4022:Sall3 UTSW 18 80969840 missense probably benign 0.05
R4050:Sall3 UTSW 18 80971482 missense probably benign 0.03
R4085:Sall3 UTSW 18 80972133 missense probably damaging 0.99
R4764:Sall3 UTSW 18 80974476 missense probably damaging 0.99
R4874:Sall3 UTSW 18 80973973 missense probably benign 0.33
R4948:Sall3 UTSW 18 80971411 missense probably benign 0.20
R5274:Sall3 UTSW 18 80969837 missense probably benign 0.15
R5602:Sall3 UTSW 18 80972812 missense probably benign
R6063:Sall3 UTSW 18 80974255 missense possibly damaging 0.52
R6256:Sall3 UTSW 18 80969861 missense possibly damaging 0.74
R6431:Sall3 UTSW 18 80973187 missense possibly damaging 0.94
R6523:Sall3 UTSW 18 80973188 missense possibly damaging 0.68
R6719:Sall3 UTSW 18 80971506 missense probably damaging 0.99
R6861:Sall3 UTSW 18 80974375 nonsense probably null
R7078:Sall3 UTSW 18 80974099 missense probably damaging 0.97
R7107:Sall3 UTSW 18 80973754 missense probably benign 0.01
R7108:Sall3 UTSW 18 80973754 missense probably benign 0.01
R7453:Sall3 UTSW 18 80972040 missense probably benign 0.07
R7491:Sall3 UTSW 18 80972705 missense probably benign 0.03
R7496:Sall3 UTSW 18 80973364 missense probably benign 0.07
R7584:Sall3 UTSW 18 80974530 missense probably benign 0.00
R7599:Sall3 UTSW 18 80972052 missense possibly damaging 0.56
R7809:Sall3 UTSW 18 80974360 missense probably benign 0.00
R8244:Sall3 UTSW 18 80973754 missense probably benign 0.01
R8245:Sall3 UTSW 18 80973754 missense probably benign 0.01
R8335:Sall3 UTSW 18 80969586 missense probably benign 0.35
R8360:Sall3 UTSW 18 80974017 missense probably benign 0.31
R8410:Sall3 UTSW 18 80973754 missense probably benign 0.01
R8476:Sall3 UTSW 18 80972118 nonsense probably null
R8712:Sall3 UTSW 18 80974021 missense probably benign 0.03
R8726:Sall3 UTSW 18 80986493 missense possibly damaging 0.89
Z1176:Sall3 UTSW 18 80972760 missense probably benign 0.19
Z1177:Sall3 UTSW 18 80974276 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GTTGCCCTTGGTGGAAAAG -3'
(R):5'- CATCCAGCACTGTAGGCAAC -3'

Sequencing Primer
(F):5'- CCCGCAGATGTTACATTTGAAGG -3'
(R):5'- ACTGTAGGCAACGCGGTG -3'
Posted On2020-07-28