Incidental Mutation 'R8249:Tmem156'
ID640321
Institutional Source Beutler Lab
Gene Symbol Tmem156
Ensembl Gene ENSMUSG00000037913
Gene Nametransmembrane protein 156
SynonymsLOC243025
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R8249 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location65054346-65092132 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 65075626 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 186 (R186*)
Ref Sequence ENSEMBL: ENSMUSP00000044102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043352] [ENSMUST00000212080] [ENSMUST00000212194] [ENSMUST00000212640]
Predicted Effect probably null
Transcript: ENSMUST00000043352
AA Change: R186*
SMART Domains Protein: ENSMUSP00000044102
Gene: ENSMUSG00000037913
AA Change: R186*

DomainStartEndE-ValueType
transmembrane domain 5 22 N/A INTRINSIC
Pfam:TMEM156 39 264 1.2e-111 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000212080
AA Change: R198*
Predicted Effect probably null
Transcript: ENSMUST00000212194
AA Change: R163*
Predicted Effect probably null
Transcript: ENSMUST00000212640
AA Change: R134*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,321,812 S441P probably benign Het
Adck2 C T 6: 39,585,733 R513* probably null Het
Agbl2 G A 2: 90,797,564 G238R probably damaging Het
Apoa1bp A T 3: 88,058,388 W35R possibly damaging Het
Arhgap12 A T 18: 6,027,635 I736N probably damaging Het
AW554918 C T 18: 25,339,718 T193I probably benign Het
Bscl2 T C 19: 8,846,520 Y270H probably damaging Het
Btd T C 14: 31,665,948 Y112H probably damaging Het
Camk2d C T 3: 126,797,729 H283Y probably damaging Het
Cnga1 T C 5: 72,605,394 Y259C probably benign Het
Dnm3 A T 1: 162,477,743 C27* probably null Het
Fam126b G A 1: 58,534,637 S336L probably benign Het
Fbxo48 T A 11: 16,953,433 S20T possibly damaging Het
Fkbp6 A G 5: 135,349,952 S14P possibly damaging Het
Gcfc2 T C 6: 81,956,951 F730L probably benign Het
Gm136 C A 4: 34,750,955 R106L probably benign Het
Gpr165 C A X: 96,714,017 D7E probably benign Het
Grin2c C T 11: 115,253,837 R621Q probably damaging Het
H2-M11 T A 17: 36,549,008 W298R probably damaging Het
Hars2 A T 18: 36,788,001 I209F probably damaging Het
Hmcn1 A T 1: 150,819,366 N262K probably benign Het
Ifit1 T A 19: 34,640,989 probably null Het
Ighv1-85 T C 12: 116,000,224 D52G probably benign Het
Kit T C 5: 75,641,408 V657A probably damaging Het
Krt32 T C 11: 100,086,722 I173V probably benign Het
Lrfn3 GC GCCAGGGGAGGTGAGCGGTGGGTCACCTCCC 7: 30,359,873 probably null Het
Lrp1 C A 10: 127,605,543 S237I probably benign Het
Map3k9 T C 12: 81,780,777 D33G unknown Het
Mroh7 T C 4: 106,721,212 T90A probably benign Het
Mterf1a A C 5: 3,891,550 I106S probably damaging Het
Mtrf1 C A 14: 79,401,479 A17E probably benign Het
Musk T G 4: 58,368,926 L635R probably damaging Het
Nlrp9c T A 7: 26,375,353 K806* probably null Het
Pi4k2a A G 19: 42,115,062 E337G probably benign Het
Pwwp2b G T 7: 139,254,843 G67C probably damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Scn10a T A 9: 119,617,774 Y1396F probably damaging Het
Sdk1 A T 5: 142,188,015 probably null Het
Serpina1f C T 12: 103,693,768 G85E probably damaging Het
Tceanc2 G A 4: 107,178,993 probably benign Het
Trbv16 A G 6: 41,151,998 T39A possibly damaging Het
Tti1 C G 2: 158,000,715 S798T probably benign Het
Unc80 A T 1: 66,619,491 M1656L probably benign Het
Wnt2 C A 6: 18,030,285 M1I probably null Het
Other mutations in Tmem156
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00538:Tmem156 APN 5 65073840 missense probably damaging 1.00
IGL01064:Tmem156 APN 5 65079984 missense probably damaging 0.99
IGL01330:Tmem156 APN 5 65080182 missense probably benign 0.17
IGL03336:Tmem156 APN 5 65075764 missense probably benign 0.01
IGL03383:Tmem156 APN 5 65075697 missense probably damaging 0.98
R0526:Tmem156 UTSW 5 65075818 missense probably benign 0.02
R2006:Tmem156 UTSW 5 65079951 missense probably damaging 1.00
R4721:Tmem156 UTSW 5 65091527 missense probably benign 0.10
R4773:Tmem156 UTSW 5 65080159 missense probably damaging 1.00
R4810:Tmem156 UTSW 5 65091447 intron probably benign
R4910:Tmem156 UTSW 5 65091462 intron probably benign
R5148:Tmem156 UTSW 5 65073768 missense probably benign 0.00
R5510:Tmem156 UTSW 5 65075574 missense probably benign 0.02
R5809:Tmem156 UTSW 5 65075607 missense possibly damaging 0.55
R6033:Tmem156 UTSW 5 65075621 missense probably benign 0.35
R6033:Tmem156 UTSW 5 65075621 missense probably benign 0.35
R7731:Tmem156 UTSW 5 65075562 critical splice donor site probably null
R7772:Tmem156 UTSW 5 65080174 missense probably damaging 1.00
R7788:Tmem156 UTSW 5 65075569 missense possibly damaging 0.47
R7979:Tmem156 UTSW 5 65080009 missense possibly damaging 0.47
R8017:Tmem156 UTSW 5 65073861 missense probably damaging 1.00
R8132:Tmem156 UTSW 5 65075755 missense probably benign 0.00
RF020:Tmem156 UTSW 5 65091547 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- GCAACTCAACTTCCGGTGAC -3'
(R):5'- TCTGCAAATAACCGGTTCTCAAC -3'

Sequencing Primer
(F):5'- AACTCAACTTCCGGTGACATTTGG -3'
(R):5'- AACCTCGCTGTAGGTCTTGTCATG -3'
Posted On2020-07-28