Incidental Mutation 'R0095:Olfr510'
ID64033
Institutional Source Beutler Lab
Gene Symbol Olfr510
Ensembl Gene ENSMUSG00000096209
Gene Nameolfactory receptor 510
SynonymsMOR204-34, GA_x6K02T2PBJ9-10997715-10998659
MMRRC Submission 038381-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R0095 (G1)
Quality Score115
Status Not validated
Chromosome7
Chromosomal Location108666418-108670259 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 108668045 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 210 (I210L)
Ref Sequence ENSEMBL: ENSMUSP00000149693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076289] [ENSMUST00000213979] [ENSMUST00000216331] [ENSMUST00000217170]
Predicted Effect probably benign
Transcript: ENSMUST00000076289
AA Change: I210L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000075637
Gene: ENSMUSG00000096209
AA Change: I210L

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 3e-50 PFAM
Pfam:7tm_1 44 293 4e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210621
AA Change: I210L
Predicted Effect probably benign
Transcript: ENSMUST00000213979
AA Change: I210L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000216331
AA Change: I210L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000217170
AA Change: I210L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Meta Mutation Damage Score 0.1337 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anxa8 G A 14: 34,086,071 A6T probably benign Het
Bicc1 T A 10: 70,961,158 I42F probably damaging Het
Cutc T C 19: 43,753,199 W13R probably benign Het
F5 A T 1: 164,191,968 R671* probably null Het
Fam84b T C 15: 60,823,576 Y107C probably damaging Het
Fer A T 17: 63,941,326 E361V possibly damaging Het
Hnrnpa3 G T 2: 75,661,696 R52L probably damaging Het
Igsf10 A T 3: 59,331,196 Y521* probably null Het
Mmp1a G A 9: 7,465,620 G186D possibly damaging Het
Naip1 T C 13: 100,423,083 T1138A probably benign Het
Necab1 T A 4: 14,960,027 N307Y possibly damaging Het
Plekha5 T C 6: 140,528,597 F84L probably damaging Het
Rpl6 T G 5: 121,205,839 V115G possibly damaging Het
Sec16a A T 2: 26,425,760 probably null Het
Tpsg1 T C 17: 25,372,554 W43R probably damaging Het
Unc45a T C 7: 80,329,543 D567G probably damaging Het
Usp30 T A 5: 114,105,840 F157I probably damaging Het
Zfp345 T A 2: 150,472,300 H439L probably damaging Het
Other mutations in Olfr510
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Olfr510 APN 7 108667700 missense possibly damaging 0.61
IGL00952:Olfr510 APN 7 108668238 missense possibly damaging 0.89
IGL01358:Olfr510 APN 7 108667662 missense possibly damaging 0.90
IGL01663:Olfr510 APN 7 108667891 missense probably benign 0.01
IGL02686:Olfr510 APN 7 108667886 missense probably benign 0.00
PIT4466001:Olfr510 UTSW 7 108667536 missense possibly damaging 0.52
R0095:Olfr510 UTSW 7 108668045 missense probably benign 0.00
R0792:Olfr510 UTSW 7 108668157 missense probably damaging 1.00
R0925:Olfr510 UTSW 7 108668193 missense probably benign 0.00
R1829:Olfr510 UTSW 7 108667644 missense probably benign 0.24
R2092:Olfr510 UTSW 7 108667662 frame shift probably null
R2483:Olfr510 UTSW 7 108667662 frame shift probably null
R3619:Olfr510 UTSW 7 108667850 missense probably benign 0.00
R4386:Olfr510 UTSW 7 108668253 missense probably damaging 0.99
R5298:Olfr510 UTSW 7 108668072 missense probably benign 0.00
R5622:Olfr510 UTSW 7 108668082 missense probably benign
R6079:Olfr510 UTSW 7 108668205 missense probably damaging 0.97
R6138:Olfr510 UTSW 7 108668205 missense probably damaging 0.97
R8359:Olfr510 UTSW 7 108668311 missense probably benign 0.00
U15987:Olfr510 UTSW 7 108668205 missense probably damaging 0.97
Z1177:Olfr510 UTSW 7 108667836 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTGTGGCAATCTGCAATCCACTG -3'
(R):5'- CCAAGCTGTTTCTTCAGAGCACCC -3'

Sequencing Primer
(F):5'- CCAAACAAGTGTGTATCCAATTGC -3'
(R):5'- TGGGAATCACCACCATGTAG -3'
Posted On2013-08-06