Incidental Mutation 'R8249:AW554918'
ID640346
Institutional Source Beutler Lab
Gene Symbol AW554918
Ensembl Gene ENSMUSG00000033632
Gene Nameexpressed sequence AW554918
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R8249 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location25168999-25467321 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 25339718 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 193 (T193I)
Ref Sequence ENSEMBL: ENSMUSP00000095248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036619] [ENSMUST00000097643] [ENSMUST00000100131] [ENSMUST00000159605] [ENSMUST00000160530] [ENSMUST00000165400]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036619
AA Change: T193I

PolyPhen 2 Score 0.543 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000046227
Gene: ENSMUSG00000033632
AA Change: T193I

DomainStartEndE-ValueType
Pfam:KIAA1328 92 414 1.4e-154 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097643
AA Change: T193I

PolyPhen 2 Score 0.329 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000095248
Gene: ENSMUSG00000033632
AA Change: T193I

DomainStartEndE-ValueType
Pfam:KIAA1328 92 414 2.5e-154 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100131
SMART Domains Protein: ENSMUSP00000097708
Gene: ENSMUSG00000033632

DomainStartEndE-ValueType
Pfam:KIAA1328 1 211 9.6e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159605
Predicted Effect probably benign
Transcript: ENSMUST00000160530
Predicted Effect probably benign
Transcript: ENSMUST00000165400
AA Change: T193I

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000128437
Gene: ENSMUSG00000033632
AA Change: T193I

DomainStartEndE-ValueType
Pfam:KIAA1328 92 414 1.6e-160 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,321,812 S441P probably benign Het
Adck2 C T 6: 39,585,733 R513* probably null Het
Agbl2 G A 2: 90,797,564 G238R probably damaging Het
Apoa1bp A T 3: 88,058,388 W35R possibly damaging Het
Arhgap12 A T 18: 6,027,635 I736N probably damaging Het
Bscl2 T C 19: 8,846,520 Y270H probably damaging Het
Btd T C 14: 31,665,948 Y112H probably damaging Het
Camk2d C T 3: 126,797,729 H283Y probably damaging Het
Cnga1 T C 5: 72,605,394 Y259C probably benign Het
Dnm3 A T 1: 162,477,743 C27* probably null Het
Fam126b G A 1: 58,534,637 S336L probably benign Het
Fbxo48 T A 11: 16,953,433 S20T possibly damaging Het
Fkbp6 A G 5: 135,349,952 S14P possibly damaging Het
Gcfc2 T C 6: 81,956,951 F730L probably benign Het
Gm136 C A 4: 34,750,955 R106L probably benign Het
Gpr165 C A X: 96,714,017 D7E probably benign Het
Grin2c C T 11: 115,253,837 R621Q probably damaging Het
H2-M11 T A 17: 36,549,008 W298R probably damaging Het
Hars2 A T 18: 36,788,001 I209F probably damaging Het
Hmcn1 A T 1: 150,819,366 N262K probably benign Het
Ifit1 T A 19: 34,640,989 probably null Het
Ighv1-85 T C 12: 116,000,224 D52G probably benign Het
Kit T C 5: 75,641,408 V657A probably damaging Het
Krt32 T C 11: 100,086,722 I173V probably benign Het
Lrfn3 GC GCCAGGGGAGGTGAGCGGTGGGTCACCTCCC 7: 30,359,873 probably null Het
Lrp1 C A 10: 127,605,543 S237I probably benign Het
Map3k9 T C 12: 81,780,777 D33G unknown Het
Mroh7 T C 4: 106,721,212 T90A probably benign Het
Mterf1a A C 5: 3,891,550 I106S probably damaging Het
Mtrf1 C A 14: 79,401,479 A17E probably benign Het
Musk T G 4: 58,368,926 L635R probably damaging Het
Nlrp9c T A 7: 26,375,353 K806* probably null Het
Pi4k2a A G 19: 42,115,062 E337G probably benign Het
Pwwp2b G T 7: 139,254,843 G67C probably damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Scn10a T A 9: 119,617,774 Y1396F probably damaging Het
Sdk1 A T 5: 142,188,015 probably null Het
Serpina1f C T 12: 103,693,768 G85E probably damaging Het
Tceanc2 G A 4: 107,178,993 probably benign Het
Tmem156 T A 5: 65,075,626 R186* probably null Het
Trbv16 A G 6: 41,151,998 T39A possibly damaging Het
Tti1 C G 2: 158,000,715 S798T probably benign Het
Unc80 A T 1: 66,619,491 M1656L probably benign Het
Wnt2 C A 6: 18,030,285 M1I probably null Het
Other mutations in AW554918
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:AW554918 APN 18 25420065 nonsense probably null
IGL01443:AW554918 APN 18 25344955 missense probably damaging 1.00
IGL01973:AW554918 APN 18 25419999 missense probably damaging 1.00
IGL02743:AW554918 APN 18 25289944 nonsense probably null
PIT4802001:AW554918 UTSW 18 25340075 missense possibly damaging 0.90
R0081:AW554918 UTSW 18 25344902 missense probably benign 0.00
R0567:AW554918 UTSW 18 25400035 missense possibly damaging 0.83
R0709:AW554918 UTSW 18 25463654 missense probably damaging 1.00
R1052:AW554918 UTSW 18 25420010 missense probably benign 0.05
R1418:AW554918 UTSW 18 25339699 splice site probably null
R1530:AW554918 UTSW 18 25400104 missense probably damaging 0.97
R2406:AW554918 UTSW 18 25340287 missense possibly damaging 0.95
R3414:AW554918 UTSW 18 25400072 missense possibly damaging 0.76
R3815:AW554918 UTSW 18 25400047 missense probably benign 0.42
R4683:AW554918 UTSW 18 25339795 missense probably benign 0.04
R4722:AW554918 UTSW 18 25174715 nonsense probably null
R4843:AW554918 UTSW 18 25340000 missense probably benign 0.00
R5199:AW554918 UTSW 18 25340299 missense probably damaging 1.00
R5279:AW554918 UTSW 18 25175431 missense possibly damaging 0.95
R5580:AW554918 UTSW 18 25339865 missense probably damaging 1.00
R7259:AW554918 UTSW 18 25289849 splice site probably null
R7388:AW554918 UTSW 18 25340113 missense probably benign 0.05
R7399:AW554918 UTSW 18 25169060 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- GTAACCTTCAGAATTTGCACTCC -3'
(R):5'- ATGAAGTGTTATTGGCCTCAAGG -3'

Sequencing Primer
(F):5'- CCCCCTATAGCTTTGCTGAAAGATAG -3'
(R):5'- GTGTTATTGGCCTCAAGGAATTATTC -3'
Posted On2020-07-28