Incidental Mutation 'R8248:Dnajb2'
ID640352
Institutional Source Beutler Lab
Gene Symbol Dnajb2
Ensembl Gene ENSMUSG00000026203
Gene NameDnaJ heat shock protein family (Hsp40) member B2
SynonymsmDj8, 2700059H22Rik, Dnajb10
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8248 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location75236406-75245692 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 75243582 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 248 (D248E)
Ref Sequence ENSEMBL: ENSMUSP00000140566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027404] [ENSMUST00000055223] [ENSMUST00000082158] [ENSMUST00000185403] [ENSMUST00000185654] [ENSMUST00000187058] [ENSMUST00000188290] [ENSMUST00000188346] [ENSMUST00000188931]
Predicted Effect probably benign
Transcript: ENSMUST00000027404
SMART Domains Protein: ENSMUSP00000027404
Gene: ENSMUSG00000026204

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
RESP18 63 164 1.5e-51 SMART
low complexity region 174 201 N/A INTRINSIC
low complexity region 217 235 N/A INTRINSIC
low complexity region 360 368 N/A INTRINSIC
Pfam:Receptor_IA-2 471 559 7e-33 PFAM
transmembrane domain 579 601 N/A INTRINSIC
low complexity region 650 679 N/A INTRINSIC
PTPc 710 973 1.2e-112 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000055223
AA Change: D230E

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000052520
Gene: ENSMUSG00000026203
AA Change: D230E

DomainStartEndE-ValueType
DnaJ 2 61 1.46e-29 SMART
low complexity region 67 78 N/A INTRINSIC
low complexity region 119 148 N/A INTRINSIC
UIM 189 208 3.05e1 SMART
UIM 232 251 5.19e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000082158
AA Change: D248E

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000080796
Gene: ENSMUSG00000026203
AA Change: D248E

DomainStartEndE-ValueType
DnaJ 2 61 2.1e-30 SMART
low complexity region 85 96 N/A INTRINSIC
low complexity region 137 166 N/A INTRINSIC
UIM 207 226 3.05e1 SMART
UIM 250 269 5.19e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185403
SMART Domains Protein: ENSMUSP00000139982
Gene: ENSMUSG00000026203

DomainStartEndE-ValueType
DnaJ 2 61 2.8e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185654
SMART Domains Protein: ENSMUSP00000140456
Gene: ENSMUSG00000026203

DomainStartEndE-ValueType
DnaJ 2 61 1.3e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187058
AA Change: D230E

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000140637
Gene: ENSMUSG00000026203
AA Change: D230E

DomainStartEndE-ValueType
DnaJ 2 61 1.46e-29 SMART
low complexity region 67 78 N/A INTRINSIC
low complexity region 119 148 N/A INTRINSIC
UIM 189 208 3.05e1 SMART
UIM 232 251 5.19e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188290
AA Change: D248E

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000140634
Gene: ENSMUSG00000026203
AA Change: D248E

DomainStartEndE-ValueType
DnaJ 2 61 2.1e-30 SMART
low complexity region 85 96 N/A INTRINSIC
low complexity region 137 166 N/A INTRINSIC
UIM 207 226 3.05e1 SMART
UIM 250 269 5.19e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188346
AA Change: D248E

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000140588
Gene: ENSMUSG00000026203
AA Change: D248E

DomainStartEndE-ValueType
DnaJ 2 61 2.1e-30 SMART
low complexity region 85 96 N/A INTRINSIC
low complexity region 137 166 N/A INTRINSIC
UIM 207 226 3.05e1 SMART
UIM 250 269 5.19e-2 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000140566
Gene: ENSMUSG00000026203
AA Change: D248E

DomainStartEndE-ValueType
DnaJ 2 61 2.1e-30 SMART
low complexity region 85 96 N/A INTRINSIC
low complexity region 137 166 N/A INTRINSIC
UIM 207 226 3.05e1 SMART
UIM 250 269 5.19e-2 SMART
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is almost exclusively expressed in the brain, mainly in the neuronal layers. It encodes a protein that shows sequence similarity to bacterial DnaJ protein and the yeast homologs. In bacteria, this protein is implicated in protein folding and protein complex dissociation. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2011]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930003A15Rik T C 16: 19,883,806 D24G noncoding transcript Het
Adam32 A G 8: 24,901,470 S343P possibly damaging Het
Agbl2 G A 2: 90,797,564 G238R probably damaging Het
Ahi1 T A 10: 20,972,092 D466E probably benign Het
Ahnak T A 19: 9,001,946 V198E probably damaging Het
Ank2 T A 3: 126,937,785 H658L possibly damaging Het
Atp8b5 T A 4: 43,366,072 I781N probably damaging Het
Bloc1s6 A T 2: 122,742,645 R47* probably null Het
Clk2 G A 3: 89,173,504 V266M probably damaging Het
Cul9 A C 17: 46,530,014 Y777D probably damaging Het
Dcp1a C T 14: 30,479,598 probably benign Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Dpy19l1 T C 9: 24,502,895 H79R probably benign Het
Elmo1 T C 13: 20,600,201 S643P probably damaging Het
Evi5 A G 5: 107,818,887 probably null Het
Fam76b T C 9: 13,831,102 C110R probably damaging Het
Galnt7 T A 8: 57,538,188 K429N probably benign Het
Gm10142 T A 10: 77,716,116 C104S probably damaging Het
Gm7298 A C 6: 121,787,443 H1427P probably benign Het
Golga7b A T 19: 42,266,871 I87F probably damaging Het
Gpr165 C A X: 96,714,017 D7E probably benign Het
Gpr25 C A 1: 136,260,677 R66L probably benign Het
H2-Q2 A G 17: 35,344,865 N241D probably benign Het
Il1a T C 2: 129,302,961 D179G probably benign Het
Itch T C 2: 155,206,383 probably null Het
Itsn2 T C 12: 4,662,052 V913A probably benign Het
Kdm1b T A 13: 47,071,878 probably benign Het
Lama4 T C 10: 39,061,379 I655T possibly damaging Het
Lats1 T A 10: 7,705,903 S817R probably damaging Het
Lrrc8c A T 5: 105,607,867 M503L probably benign Het
Mast4 T C 13: 102,738,721 T1380A probably damaging Het
Mfap1a G T 2: 121,506,495 T16K possibly damaging Het
Mroh2b C T 15: 4,931,104 T773I probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nudt7 A G 8: 114,151,997 Y255C probably benign Het
Pfas T C 11: 69,000,263 T310A probably damaging Het
Pkhd1l1 T G 15: 44,543,546 I2393R probably damaging Het
Pmm1 A C 15: 81,960,731 L24R possibly damaging Het
Pram1 T C 17: 33,641,164 V235A probably benign Het
Prg4 T C 1: 150,455,126 T599A unknown Het
Prpf40b A G 15: 99,316,285 K812E unknown Het
Qars G A 9: 108,509,452 A155T probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rgs6 A G 12: 83,137,704 probably benign Het
Rom1 T A 19: 8,928,681 R165W probably damaging Het
Rps6kb2 T A 19: 4,156,988 probably benign Het
Ryr1 A T 7: 29,069,121 W2808R probably damaging Het
Sh3gl1 A G 17: 56,019,038 probably null Het
Slc22a30 A T 19: 8,370,199 M279K probably benign Het
Snx11 A G 11: 96,769,933 S184P unknown Het
Srgap1 A G 10: 121,804,817 C692R probably damaging Het
Srgap3 T C 6: 112,723,143 N982S probably damaging Het
Stac T A 9: 111,593,745 D270V probably benign Het
Syn3 T A 10: 86,135,021 I246F probably benign Het
Tnr T C 1: 159,892,093 V980A probably damaging Het
Usp17le G T 7: 104,769,794 A47E possibly damaging Het
Vmn2r118 T C 17: 55,610,936 N192S probably benign Het
Zmym4 C A 4: 126,905,369 V725L possibly damaging Het
Other mutations in Dnajb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01490:Dnajb2 APN 1 75236890 missense probably damaging 1.00
R0494:Dnajb2 UTSW 1 75239634 unclassified probably benign
R2118:Dnajb2 UTSW 1 75237477 missense probably damaging 1.00
R3837:Dnajb2 UTSW 1 75241480 critical splice donor site probably null
R3838:Dnajb2 UTSW 1 75241480 critical splice donor site probably null
R3839:Dnajb2 UTSW 1 75241480 critical splice donor site probably null
R4105:Dnajb2 UTSW 1 75236899 nonsense probably null
R4108:Dnajb2 UTSW 1 75236899 nonsense probably null
R4858:Dnajb2 UTSW 1 75243554 missense possibly damaging 0.96
R7115:Dnajb2 UTSW 1 75243662 missense
R7960:Dnajb2 UTSW 1 75241411 missense
R8512:Dnajb2 UTSW 1 75241431 missense
Predicted Primers PCR Primer
(F):5'- TTACTGGGTAAGGTGGTCCC -3'
(R):5'- GGTTCTCAGAGAATGTGGCAGC -3'

Sequencing Primer
(F):5'- TAAGGTGGTCCCGCATGAG -3'
(R):5'- AGGCCTTCTCCTCTGAGGAC -3'
Posted On2020-07-28