Incidental Mutation 'R8248:Itch'
ID640362
Institutional Source Beutler Lab
Gene Symbol Itch
Ensembl Gene ENSMUSG00000027598
Gene Nameitchy, E3 ubiquitin protein ligase
Synonyms8030492O04Rik, C230047C07Rik, 6720481N21Rik, AIP4
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8248 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location155133509-155226855 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 155206383 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000029126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029126] [ENSMUST00000109685]
PDB Structure
Itch E3 ubiquitin ligase WW3 domain [SOLUTION NMR]
Mouse Itch 3rd WW domain complex with the Epstein-Barr virus latent membrane protein 2A derived peptide EEPPPPYED [SOLUTION NMR]
Mouse Itch 3rd domain phosphorylated in T30 [SOLUTION NMR]
Predicted Effect probably null
Transcript: ENSMUST00000029126
SMART Domains Protein: ENSMUSP00000029126
Gene: ENSMUSG00000027598

DomainStartEndE-ValueType
C2 19 114 3.56e-12 SMART
low complexity region 195 206 N/A INTRINSIC
low complexity region 209 226 N/A INTRINSIC
low complexity region 230 259 N/A INTRINSIC
WW 288 320 1.07e-12 SMART
WW 321 352 3.86e-10 SMART
WW 400 432 7.36e-16 SMART
WW 440 472 6.82e-11 SMART
HECTc 528 864 7.04e-179 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109685
SMART Domains Protein: ENSMUSP00000105307
Gene: ENSMUSG00000027598

DomainStartEndE-ValueType
C2 19 114 3.56e-12 SMART
low complexity region 195 206 N/A INTRINSIC
low complexity region 209 226 N/A INTRINSIC
low complexity region 230 259 N/A INTRINSIC
WW 288 320 1.07e-12 SMART
WW 321 352 3.86e-10 SMART
WW 400 432 7.36e-16 SMART
WW 440 472 6.82e-11 SMART
HECTc 528 864 7.04e-179 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Nedd4 family of HECT domain E3 ubiquitin ligases. HECT domain E3 ubiquitin ligases transfer ubiquitin from E2 ubiquitin-conjugating enzymes to protein substrates, thus targeting specific proteins for lysosomal degradation. The encoded protein plays a role in multiple cellular processes including erythroid and lymphoid cell differentiation and the regulation of immune responses. Mutations in this gene are a cause of syndromic multisystem autoimmune disease. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for an ENU mutation exhibit increased total IgE levels in the peripheral blood and an enhanced IgE response to the cysteine protease allergen, papain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930003A15Rik T C 16: 19,883,806 D24G noncoding transcript Het
Adam32 A G 8: 24,901,470 S343P possibly damaging Het
Agbl2 G A 2: 90,797,564 G238R probably damaging Het
Ahi1 T A 10: 20,972,092 D466E probably benign Het
Ahnak T A 19: 9,001,946 V198E probably damaging Het
Ank2 T A 3: 126,937,785 H658L possibly damaging Het
Atp8b5 T A 4: 43,366,072 I781N probably damaging Het
Bloc1s6 A T 2: 122,742,645 R47* probably null Het
Clk2 G A 3: 89,173,504 V266M probably damaging Het
Cul9 A C 17: 46,530,014 Y777D probably damaging Het
Dcp1a C T 14: 30,479,598 probably benign Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Dnajb2 T G 1: 75,243,582 D248E Het
Dpy19l1 T C 9: 24,502,895 H79R probably benign Het
Elmo1 T C 13: 20,600,201 S643P probably damaging Het
Evi5 A G 5: 107,818,887 probably null Het
Fam76b T C 9: 13,831,102 C110R probably damaging Het
Galnt7 T A 8: 57,538,188 K429N probably benign Het
Gm10142 T A 10: 77,716,116 C104S probably damaging Het
Gm7298 A C 6: 121,787,443 H1427P probably benign Het
Golga7b A T 19: 42,266,871 I87F probably damaging Het
Gpr165 C A X: 96,714,017 D7E probably benign Het
Gpr25 C A 1: 136,260,677 R66L probably benign Het
H2-Q2 A G 17: 35,344,865 N241D probably benign Het
Il1a T C 2: 129,302,961 D179G probably benign Het
Itsn2 T C 12: 4,662,052 V913A probably benign Het
Kdm1b T A 13: 47,071,878 probably benign Het
Lama4 T C 10: 39,061,379 I655T possibly damaging Het
Lats1 T A 10: 7,705,903 S817R probably damaging Het
Lrrc8c A T 5: 105,607,867 M503L probably benign Het
Mast4 T C 13: 102,738,721 T1380A probably damaging Het
Mfap1a G T 2: 121,506,495 T16K possibly damaging Het
Mroh2b C T 15: 4,931,104 T773I probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nudt7 A G 8: 114,151,997 Y255C probably benign Het
Pfas T C 11: 69,000,263 T310A probably damaging Het
Pkhd1l1 T G 15: 44,543,546 I2393R probably damaging Het
Pmm1 A C 15: 81,960,731 L24R possibly damaging Het
Pram1 T C 17: 33,641,164 V235A probably benign Het
Prg4 T C 1: 150,455,126 T599A unknown Het
Prpf40b A G 15: 99,316,285 K812E unknown Het
Qars G A 9: 108,509,452 A155T probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rgs6 A G 12: 83,137,704 probably benign Het
Rom1 T A 19: 8,928,681 R165W probably damaging Het
Rps6kb2 T A 19: 4,156,988 probably benign Het
Ryr1 A T 7: 29,069,121 W2808R probably damaging Het
Sh3gl1 A G 17: 56,019,038 probably null Het
Slc22a30 A T 19: 8,370,199 M279K probably benign Het
Snx11 A G 11: 96,769,933 S184P unknown Het
Srgap1 A G 10: 121,804,817 C692R probably damaging Het
Srgap3 T C 6: 112,723,143 N982S probably damaging Het
Stac T A 9: 111,593,745 D270V probably benign Het
Syn3 T A 10: 86,135,021 I246F probably benign Het
Tnr T C 1: 159,892,093 V980A probably damaging Het
Usp17le G T 7: 104,769,794 A47E possibly damaging Het
Vmn2r118 T C 17: 55,610,936 N192S probably benign Het
Zmym4 C A 4: 126,905,369 V725L possibly damaging Het
Other mutations in Itch
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Itch APN 2 155213023 missense probably damaging 1.00
IGL00796:Itch APN 2 155209082 missense probably damaging 0.97
IGL01090:Itch APN 2 155206336 missense probably damaging 0.99
IGL01568:Itch APN 2 155212462 splice site probably benign
IGL01844:Itch APN 2 155172547 missense possibly damaging 0.56
IGL01844:Itch APN 2 155172486 missense possibly damaging 0.94
IGL01873:Itch APN 2 155168750 missense possibly damaging 0.68
IGL02129:Itch APN 2 155217988 splice site probably benign
IGL02386:Itch APN 2 155202261 nonsense probably null
IGL02545:Itch APN 2 155172586 splice site probably null
IGL02621:Itch APN 2 155172584 splice site probably null
IGL02708:Itch APN 2 155174044 missense probably benign 0.00
IGL02869:Itch APN 2 155173933 critical splice acceptor site probably null
Abrade UTSW 2 155209078 missense possibly damaging 0.93
prurient UTSW 2 155210502 missense probably damaging 1.00
scratch UTSW 2 155172561 missense probably damaging 0.99
R0116:Itch UTSW 2 155217983 splice site probably benign
R0207:Itch UTSW 2 155202257 missense probably benign
R0226:Itch UTSW 2 155199394 missense probably benign 0.01
R0545:Itch UTSW 2 155182298 nonsense probably null
R0689:Itch UTSW 2 155182178 missense possibly damaging 0.82
R1365:Itch UTSW 2 155213031 missense probably benign 0.00
R1406:Itch UTSW 2 155206354 missense possibly damaging 0.95
R1406:Itch UTSW 2 155206354 missense possibly damaging 0.95
R1436:Itch UTSW 2 155192145 missense probably damaging 0.96
R1639:Itch UTSW 2 155179025 splice site probably null
R1769:Itch UTSW 2 155172561 missense probably damaging 0.99
R1855:Itch UTSW 2 155172454 splice site probably benign
R1865:Itch UTSW 2 155168746 missense probably damaging 0.96
R2008:Itch UTSW 2 155210459 missense possibly damaging 0.91
R2054:Itch UTSW 2 155210576 missense probably damaging 1.00
R2196:Itch UTSW 2 155202221 missense probably benign
R2199:Itch UTSW 2 155202221 missense probably benign
R2252:Itch UTSW 2 155212339 missense probably benign 0.01
R2253:Itch UTSW 2 155212339 missense probably benign 0.01
R2348:Itch UTSW 2 155209078 missense possibly damaging 0.93
R2850:Itch UTSW 2 155202221 missense probably benign
R3021:Itch UTSW 2 155209126 missense possibly damaging 0.74
R4676:Itch UTSW 2 155199435 missense probably benign 0.05
R4716:Itch UTSW 2 155210582 critical splice donor site probably null
R4888:Itch UTSW 2 155217977 splice site probably null
R4970:Itch UTSW 2 155185593 missense possibly damaging 0.50
R6029:Itch UTSW 2 155179089 critical splice donor site probably null
R6122:Itch UTSW 2 155174065 missense probably benign 0.05
R6435:Itch UTSW 2 155209129 missense probably benign 0.01
R6449:Itch UTSW 2 155163395 splice site probably benign
R7069:Itch UTSW 2 155209994 missense probably damaging 1.00
R7083:Itch UTSW 2 155210444 missense probably damaging 1.00
R7409:Itch UTSW 2 155199382 missense probably damaging 0.99
R7689:Itch UTSW 2 155210002 missense probably damaging 0.99
R7689:Itch UTSW 2 155213067 missense probably benign 0.00
R7974:Itch UTSW 2 155192159 missense probably damaging 1.00
R8046:Itch UTSW 2 155210502 missense probably damaging 1.00
R8428:Itch UTSW 2 155168707 missense probably benign 0.38
Z1177:Itch UTSW 2 155209059 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTACAGTGGAGCAAGTGG -3'
(R):5'- GGCTGGCTGACACTAGTTACTG -3'

Sequencing Primer
(F):5'- GGAGGTGGTGGTGATGTCTCC -3'
(R):5'- GCACTGAGTGACTCTCTGAAC -3'
Posted On2020-07-28