Incidental Mutation 'R8248:Clk2'
ID640363
Institutional Source Beutler Lab
Gene Symbol Clk2
Ensembl Gene ENSMUSG00000068917
Gene NameCDC-like kinase 2
Synonyms
Accession Numbers

Genbank: NM_007712, NM_001163432

Is this an essential gene? Possibly non essential (E-score: 0.377) question?
Stock #R8248 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location89164795-89176921 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 89173504 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 266 (V266M)
Ref Sequence ENSEMBL: ENSMUSP00000113390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029684] [ENSMUST00000090927] [ENSMUST00000098941] [ENSMUST00000120697] [ENSMUST00000121212] [ENSMUST00000121931] [ENSMUST00000128318] [ENSMUST00000148265]
Predicted Effect probably benign
Transcript: ENSMUST00000029684
SMART Domains Protein: ENSMUSP00000029684
Gene: ENSMUSG00000028049

DomainStartEndE-ValueType
low complexity region 49 69 N/A INTRINSIC
coiled coil region 89 127 N/A INTRINSIC
Pfam:SCAMP 133 310 1.5e-76 PFAM
low complexity region 329 348 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000090927
AA Change: V265M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000088445
Gene: ENSMUSG00000068917
AA Change: V265M

DomainStartEndE-ValueType
low complexity region 24 50 N/A INTRINSIC
low complexity region 54 72 N/A INTRINSIC
low complexity region 105 137 N/A INTRINSIC
S_TKc 161 477 1.46e-75 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098941
SMART Domains Protein: ENSMUSP00000096540
Gene: ENSMUSG00000028049

DomainStartEndE-ValueType
low complexity region 49 69 N/A INTRINSIC
coiled coil region 89 127 N/A INTRINSIC
Pfam:SCAMP 133 229 5.5e-46 PFAM
Pfam:SCAMP 227 276 2.2e-11 PFAM
low complexity region 295 314 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120697
SMART Domains Protein: ENSMUSP00000112846
Gene: ENSMUSG00000028049

DomainStartEndE-ValueType
low complexity region 50 70 N/A INTRINSIC
coiled coil region 90 128 N/A INTRINSIC
Pfam:SCAMP 135 310 1.1e-67 PFAM
low complexity region 330 349 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121212
AA Change: V266M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000113390
Gene: ENSMUSG00000068917
AA Change: V266M

DomainStartEndE-ValueType
low complexity region 24 50 N/A INTRINSIC
low complexity region 54 73 N/A INTRINSIC
low complexity region 106 138 N/A INTRINSIC
S_TKc 162 478 1.46e-75 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121931
AA Change: V267M

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113861
Gene: ENSMUSG00000068917
AA Change: V267M

DomainStartEndE-ValueType
low complexity region 24 50 N/A INTRINSIC
low complexity region 54 73 N/A INTRINSIC
low complexity region 106 142 N/A INTRINSIC
S_TKc 163 479 1.46e-75 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128318
SMART Domains Protein: ENSMUSP00000115761
Gene: ENSMUSG00000068917

DomainStartEndE-ValueType
low complexity region 24 50 N/A INTRINSIC
low complexity region 54 73 N/A INTRINSIC
low complexity region 103 133 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148265
SMART Domains Protein: ENSMUSP00000122634
Gene: ENSMUSG00000068917

DomainStartEndE-ValueType
low complexity region 24 50 N/A INTRINSIC
low complexity region 54 73 N/A INTRINSIC
low complexity region 106 138 N/A INTRINSIC
Pfam:Pkinase 162 249 7.4e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a dual specificity protein kinase that phosphorylates serine/threonine and tyrosine-containing substrates. Activity of this protein regulates serine- and arginine-rich (SR) proteins of the spliceosomal complex, thereby influencing alternative transcript splicing. Chromosomal translocations have been characterized between this locus and the PAFAH1B3 (platelet-activating factor acetylhydrolase 1b, catalytic subunit 3 (29kDa)) gene on chromosome 19, resulting in the production of a fusion protein. Note that this gene is distinct from the TELO2 gene (GeneID:9894), which shares the CLK2 alias, but encodes a protein that is involved in telomere length regulation. There is a pseudogene for this gene on chromosome 7. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
PHENOTYPE: Mice homozygous for a conditional allele activated in the liver exhibit decreased hepatic fatty acid oxidation and ketogenesis. [provided by MGI curators]
Allele List at MGI

 All alleles(12) : Targeted, other(1) Gene trapped(11)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930003A15Rik T C 16: 19,883,806 D24G noncoding transcript Het
Adam32 A G 8: 24,901,470 S343P possibly damaging Het
Agbl2 G A 2: 90,797,564 G238R probably damaging Het
Ahi1 T A 10: 20,972,092 D466E probably benign Het
Ahnak T A 19: 9,001,946 V198E probably damaging Het
Ank2 T A 3: 126,937,785 H658L possibly damaging Het
Atp2b4 TTCTTC TTCTTCGTCTTC 1: 133,701,718 probably benign Het
Atp2b4 TCTTCT TCTTCTCCTTCT 1: 133,701,743 probably benign Het
Atp8b5 T A 4: 43,366,072 I781N probably damaging Het
Bloc1s6 A T 2: 122,742,645 R47* probably null Het
Cul9 A C 17: 46,530,014 Y777D probably damaging Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Dcp1a C T 14: 30,479,598 probably benign Het
Dnajb2 T G 1: 75,243,582 D248E Het
Dpy19l1 T C 9: 24,502,895 H79R probably benign Het
Elmo1 T C 13: 20,600,201 S643P probably damaging Het
Evi5 A G 5: 107,818,887 probably null Het
Fam76b T C 9: 13,831,102 C110R probably damaging Het
Galnt7 T A 8: 57,538,188 K429N probably benign Het
Gm10142 T A 10: 77,716,116 C104S probably damaging Het
Gm7298 A C 6: 121,787,443 H1427P probably benign Het
Golga7b A T 19: 42,266,871 I87F probably damaging Het
Gpr165 C A X: 96,714,017 D7E probably benign Het
Gpr25 C A 1: 136,260,677 R66L probably benign Het
H2-Q2 A G 17: 35,344,865 N241D probably benign Het
Il1a T C 2: 129,302,961 D179G probably benign Het
Itch T C 2: 155,206,383 probably null Het
Itsn2 T C 12: 4,662,052 V913A probably benign Het
Lama4 T C 10: 39,061,379 I655T possibly damaging Het
Lats1 T A 10: 7,705,903 S817R probably damaging Het
Lrrc8c A T 5: 105,607,867 M503L probably benign Het
Mast4 T C 13: 102,738,721 T1380A probably damaging Het
Mfap1a G T 2: 121,506,495 T16K possibly damaging Het
Mroh2b C T 15: 4,931,104 T773I probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nudt7 A G 8: 114,151,997 Y255C probably benign Het
Pfas T C 11: 69,000,263 T310A probably damaging Het
Pkhd1l1 T G 15: 44,543,546 I2393R probably damaging Het
Pmm1 A C 15: 81,960,731 L24R possibly damaging Het
Pram1 T C 17: 33,641,164 V235A probably benign Het
Prg4 T C 1: 150,455,126 T599A unknown Het
Prpf40b A G 15: 99,316,285 K812E unknown Het
Qars G A 9: 108,509,452 A155T probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rom1 T A 19: 8,928,681 R165W probably damaging Het
Ryr1 A T 7: 29,069,121 W2808R probably damaging Het
Sh3gl1 A G 17: 56,019,038 probably null Het
Slc22a30 A T 19: 8,370,199 M279K probably benign Het
Snx11 A G 11: 96,769,933 S184P unknown Het
Srgap1 A G 10: 121,804,817 C692R probably damaging Het
Srgap3 T C 6: 112,723,143 N982S probably damaging Het
Stac T A 9: 111,593,745 D270V probably benign Het
Syn3 T A 10: 86,135,021 I246F probably benign Het
Tnr T C 1: 159,892,093 V980A probably damaging Het
Usp17le G T 7: 104,769,794 A47E possibly damaging Het
Vmn2r118 T C 17: 55,610,936 N192S probably benign Het
Zmym4 C A 4: 126,905,369 V725L possibly damaging Het
Other mutations in Clk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Clk2 APN 3 89175422 missense probably damaging 0.99
IGL01152:Clk2 APN 3 89176511 missense probably damaging 0.99
IGL02342:Clk2 APN 3 89175691 missense probably benign 0.00
IGL02387:Clk2 APN 3 89176391 unclassified probably benign
IGL02553:Clk2 APN 3 89175713 missense probably damaging 1.00
IGL02861:Clk2 APN 3 89173399 missense probably damaging 0.99
3-1:Clk2 UTSW 3 89170348 missense probably damaging 0.98
R1511:Clk2 UTSW 3 89168703 missense probably damaging 1.00
R1892:Clk2 UTSW 3 89175195 missense possibly damaging 0.48
R3796:Clk2 UTSW 3 89175689 missense probably benign
R3844:Clk2 UTSW 3 89170403 missense probably benign 0.06
R4737:Clk2 UTSW 3 89168709 missense probably benign 0.44
R5138:Clk2 UTSW 3 89175499 unclassified probably benign
R5413:Clk2 UTSW 3 89173478 missense probably benign 0.22
R5447:Clk2 UTSW 3 89167191 missense possibly damaging 0.92
R5538:Clk2 UTSW 3 89175655 missense probably damaging 0.99
R6128:Clk2 UTSW 3 89174224 missense probably damaging 1.00
R7346:Clk2 UTSW 3 89173545 critical splice donor site probably null
R7578:Clk2 UTSW 3 89176500 missense probably benign
R7762:Clk2 UTSW 3 89167191 missense probably benign 0.13
R7894:Clk2 UTSW 3 89168894 missense possibly damaging 0.95
R8295:Clk2 UTSW 3 89173459 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATACAGACTTTCATTTTGGTGGG -3'
(R):5'- CAGTCAAGGTGGTAAGTCGG -3'

Sequencing Primer
(F):5'- GGTGCTGGGTTTTGGGAACTTATTAG -3'
(R):5'- GAGGAGGAGCTGCCATGAC -3'
Posted On2020-07-28