Incidental Mutation 'R8248:Atp8b5'
ID640365
Institutional Source Beutler Lab
Gene Symbol Atp8b5
Ensembl Gene ENSMUSG00000028457
Gene NameATPase, class I, type 8B, member 5
Synonyms4930417M19Rik, FetA
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R8248 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location43267159-43373833 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 43366072 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 781 (I781N)
Ref Sequence ENSEMBL: ENSMUSP00000103575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107937] [ENSMUST00000107942]
Predicted Effect probably benign
Transcript: ENSMUST00000107937
Predicted Effect probably damaging
Transcript: ENSMUST00000107942
AA Change: I781N

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103575
Gene: ENSMUSG00000028457
AA Change: I781N

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 38 104 1.8e-26 PFAM
Pfam:E1-E2_ATPase 103 375 4.9e-9 PFAM
Pfam:HAD 413 847 2e-18 PFAM
Pfam:Cation_ATPase 495 594 1e-9 PFAM
Pfam:PhoLip_ATPase_C 864 1118 2.6e-77 PFAM
low complexity region 1171 1180 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930003A15Rik T C 16: 19,883,806 D24G noncoding transcript Het
Adam32 A G 8: 24,901,470 S343P possibly damaging Het
Agbl2 G A 2: 90,797,564 G238R probably damaging Het
Ahi1 T A 10: 20,972,092 D466E probably benign Het
Ahnak T A 19: 9,001,946 V198E probably damaging Het
Ank2 T A 3: 126,937,785 H658L possibly damaging Het
Atp2b4 TTCTTC TTCTTCGTCTTC 1: 133,701,718 probably benign Het
Atp2b4 TCTTCT TCTTCTCCTTCT 1: 133,701,743 probably benign Het
Bloc1s6 A T 2: 122,742,645 R47* probably null Het
Clk2 G A 3: 89,173,504 V266M probably damaging Het
Cul9 A C 17: 46,530,014 Y777D probably damaging Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Dcp1a C T 14: 30,479,598 probably benign Het
Dnajb2 T G 1: 75,243,582 D248E Het
Dpy19l1 T C 9: 24,502,895 H79R probably benign Het
Elmo1 T C 13: 20,600,201 S643P probably damaging Het
Evi5 A G 5: 107,818,887 probably null Het
Fam76b T C 9: 13,831,102 C110R probably damaging Het
Galnt7 T A 8: 57,538,188 K429N probably benign Het
Gm10142 T A 10: 77,716,116 C104S probably damaging Het
Gm7298 A C 6: 121,787,443 H1427P probably benign Het
Golga7b A T 19: 42,266,871 I87F probably damaging Het
Gpr165 C A X: 96,714,017 D7E probably benign Het
Gpr25 C A 1: 136,260,677 R66L probably benign Het
H2-Q2 A G 17: 35,344,865 N241D probably benign Het
Il1a T C 2: 129,302,961 D179G probably benign Het
Itch T C 2: 155,206,383 probably null Het
Itsn2 T C 12: 4,662,052 V913A probably benign Het
Lama4 T C 10: 39,061,379 I655T possibly damaging Het
Lats1 T A 10: 7,705,903 S817R probably damaging Het
Lrrc8c A T 5: 105,607,867 M503L probably benign Het
Mast4 T C 13: 102,738,721 T1380A probably damaging Het
Mfap1a G T 2: 121,506,495 T16K possibly damaging Het
Mroh2b C T 15: 4,931,104 T773I probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nudt7 A G 8: 114,151,997 Y255C probably benign Het
Pfas T C 11: 69,000,263 T310A probably damaging Het
Pkhd1l1 T G 15: 44,543,546 I2393R probably damaging Het
Pmm1 A C 15: 81,960,731 L24R possibly damaging Het
Pram1 T C 17: 33,641,164 V235A probably benign Het
Prg4 T C 1: 150,455,126 T599A unknown Het
Prpf40b A G 15: 99,316,285 K812E unknown Het
Qars G A 9: 108,509,452 A155T probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rom1 T A 19: 8,928,681 R165W probably damaging Het
Ryr1 A T 7: 29,069,121 W2808R probably damaging Het
Sh3gl1 A G 17: 56,019,038 probably null Het
Slc22a30 A T 19: 8,370,199 M279K probably benign Het
Snx11 A G 11: 96,769,933 S184P unknown Het
Srgap1 A G 10: 121,804,817 C692R probably damaging Het
Srgap3 T C 6: 112,723,143 N982S probably damaging Het
Stac T A 9: 111,593,745 D270V probably benign Het
Syn3 T A 10: 86,135,021 I246F probably benign Het
Tnr T C 1: 159,892,093 V980A probably damaging Het
Usp17le G T 7: 104,769,794 A47E possibly damaging Het
Vmn2r118 T C 17: 55,610,936 N192S probably benign Het
Zmym4 C A 4: 126,905,369 V725L possibly damaging Het
Other mutations in Atp8b5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Atp8b5 APN 4 43355567 missense probably damaging 1.00
IGL00970:Atp8b5 APN 4 43311938 missense probably benign 0.01
IGL01335:Atp8b5 APN 4 43302628 missense possibly damaging 0.90
IGL01462:Atp8b5 APN 4 43368010 missense possibly damaging 0.90
IGL01657:Atp8b5 APN 4 43291693 missense probably benign 0.04
IGL01935:Atp8b5 APN 4 43366638 missense probably benign 0.03
IGL01977:Atp8b5 APN 4 43320590 critical splice acceptor site probably null
IGL02102:Atp8b5 APN 4 43364167 missense probably benign 0.10
IGL02369:Atp8b5 APN 4 43334205 missense probably benign
IGL02456:Atp8b5 APN 4 43365578 missense probably benign 0.16
IGL02696:Atp8b5 APN 4 43369634 missense possibly damaging 0.61
IGL02826:Atp8b5 APN 4 43366770 missense probably damaging 1.00
IGL02947:Atp8b5 APN 4 43305774 missense possibly damaging 0.49
R0128:Atp8b5 UTSW 4 43369715 critical splice donor site probably null
R0130:Atp8b5 UTSW 4 43369715 critical splice donor site probably null
R0243:Atp8b5 UTSW 4 43366057 missense probably benign
R0256:Atp8b5 UTSW 4 43302576 intron probably benign
R0379:Atp8b5 UTSW 4 43361898 missense probably damaging 0.99
R0671:Atp8b5 UTSW 4 43291672 missense possibly damaging 0.83
R1109:Atp8b5 UTSW 4 43305719 intron probably benign
R1442:Atp8b5 UTSW 4 43334313 missense probably damaging 0.99
R1454:Atp8b5 UTSW 4 43302590 missense probably benign
R1469:Atp8b5 UTSW 4 43291733 critical splice donor site probably null
R1469:Atp8b5 UTSW 4 43291733 critical splice donor site probably null
R1503:Atp8b5 UTSW 4 43344430 missense probably damaging 1.00
R1580:Atp8b5 UTSW 4 43355673 missense possibly damaging 0.49
R1677:Atp8b5 UTSW 4 43372903 missense possibly damaging 0.61
R1861:Atp8b5 UTSW 4 43372906 missense probably damaging 1.00
R1899:Atp8b5 UTSW 4 43361804 missense possibly damaging 0.47
R1903:Atp8b5 UTSW 4 43357063 missense probably damaging 0.98
R1961:Atp8b5 UTSW 4 43369688 missense probably damaging 0.98
R2131:Atp8b5 UTSW 4 43370726 missense probably benign 0.33
R2971:Atp8b5 UTSW 4 43361953 splice site probably benign
R3023:Atp8b5 UTSW 4 43311957 missense possibly damaging 0.82
R3433:Atp8b5 UTSW 4 43372697 missense probably benign
R3690:Atp8b5 UTSW 4 43368055 missense probably damaging 1.00
R4157:Atp8b5 UTSW 4 43365591 missense probably damaging 0.97
R4484:Atp8b5 UTSW 4 43357016 missense probably damaging 1.00
R4510:Atp8b5 UTSW 4 43320629 missense probably damaging 1.00
R4511:Atp8b5 UTSW 4 43320629 missense probably damaging 1.00
R4679:Atp8b5 UTSW 4 43365955 missense probably benign 0.16
R4753:Atp8b5 UTSW 4 43372710 missense probably damaging 1.00
R4761:Atp8b5 UTSW 4 43308504 makesense probably null
R4784:Atp8b5 UTSW 4 43356980 missense probably damaging 0.97
R4785:Atp8b5 UTSW 4 43356980 missense probably damaging 0.97
R4855:Atp8b5 UTSW 4 43344449 missense probably benign
R5422:Atp8b5 UTSW 4 43366644 missense probably benign 0.10
R5915:Atp8b5 UTSW 4 43370577 missense probably damaging 1.00
R6228:Atp8b5 UTSW 4 43304674 missense probably damaging 1.00
R6496:Atp8b5 UTSW 4 43371003 missense probably benign 0.03
R6708:Atp8b5 UTSW 4 43334249 missense probably benign
R6931:Atp8b5 UTSW 4 43364108 critical splice acceptor site probably null
R7021:Atp8b5 UTSW 4 43355618 missense probably damaging 0.99
R7085:Atp8b5 UTSW 4 43361835 missense probably damaging 1.00
R7207:Atp8b5 UTSW 4 43357018 missense probably damaging 0.97
R7404:Atp8b5 UTSW 4 43342640 missense probably benign 0.10
R7448:Atp8b5 UTSW 4 43366021 missense probably benign
R7465:Atp8b5 UTSW 4 43271269 missense probably benign 0.00
R7526:Atp8b5 UTSW 4 43366609 missense probably damaging 0.99
R7616:Atp8b5 UTSW 4 43370823 critical splice donor site probably null
R7698:Atp8b5 UTSW 4 43366735 missense probably benign 0.27
R7883:Atp8b5 UTSW 4 43342471 missense probably damaging 0.99
R8052:Atp8b5 UTSW 4 43356982 nonsense probably null
R8218:Atp8b5 UTSW 4 43372728 critical splice donor site probably null
R8345:Atp8b5 UTSW 4 43291714 missense probably benign 0.01
X0025:Atp8b5 UTSW 4 43366774 missense probably damaging 1.00
Z1176:Atp8b5 UTSW 4 43361903 missense probably benign 0.40
Z1177:Atp8b5 UTSW 4 43370669 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- CAGATGAGACTCTGACCATGC -3'
(R):5'- CTCTGAGTAGCAAGCCACTTTAG -3'

Sequencing Primer
(F):5'- GCTGTCTTGGCTTCCAGAACAG -3'
(R):5'- CTGAGTAGCAAGCCACTTTAGTAGAG -3'
Posted On2020-07-28