Incidental Mutation 'R8248:Evi5'
ID640368
Institutional Source Beutler Lab
Gene Symbol Evi5
Ensembl Gene ENSMUSG00000011831
Gene Nameecotropic viral integration site 5
SynonymsNB4S
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8248 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location107744795-107875107 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 107818887 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112642] [ENSMUST00000124034] [ENSMUST00000128723] [ENSMUST00000138111] [ENSMUST00000155955]
Predicted Effect probably null
Transcript: ENSMUST00000112642
SMART Domains Protein: ENSMUSP00000108261
Gene: ENSMUSG00000011831

DomainStartEndE-ValueType
low complexity region 51 80 N/A INTRINSIC
Blast:TBC 81 157 2e-16 BLAST
TBC 160 371 7.92e-91 SMART
internal_repeat_1 450 477 8.83e-6 PROSPERO
internal_repeat_1 494 521 8.83e-6 PROSPERO
coiled coil region 555 717 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000124034
SMART Domains Protein: ENSMUSP00000121761
Gene: ENSMUSG00000011831

DomainStartEndE-ValueType
low complexity region 7 36 N/A INTRINSIC
Blast:TBC 37 113 3e-17 BLAST
TBC 116 327 7.92e-91 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124590
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127579
Predicted Effect probably null
Transcript: ENSMUST00000128723
SMART Domains Protein: ENSMUSP00000114845
Gene: ENSMUSG00000011831

DomainStartEndE-ValueType
low complexity region 7 36 N/A INTRINSIC
Blast:TBC 37 113 2e-16 BLAST
TBC 116 327 7.92e-91 SMART
internal_repeat_1 466 493 2.66e-6 PROSPERO
internal_repeat_1 510 537 2.66e-6 PROSPERO
coiled coil region 571 660 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132482
Predicted Effect probably null
Transcript: ENSMUST00000138111
SMART Domains Protein: ENSMUSP00000119196
Gene: ENSMUSG00000011831

DomainStartEndE-ValueType
low complexity region 7 36 N/A INTRINSIC
Blast:TBC 37 113 3e-17 BLAST
TBC 116 327 7.92e-91 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141673
Predicted Effect probably benign
Transcript: ENSMUST00000155955
SMART Domains Protein: ENSMUSP00000119758
Gene: ENSMUSG00000011831

DomainStartEndE-ValueType
Blast:TBC 18 133 3e-20 BLAST
Pfam:RabGAP-TBC 150 222 1.6e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930003A15Rik T C 16: 19,883,806 D24G noncoding transcript Het
Adam32 A G 8: 24,901,470 S343P possibly damaging Het
Agbl2 G A 2: 90,797,564 G238R probably damaging Het
Ahi1 T A 10: 20,972,092 D466E probably benign Het
Ahnak T A 19: 9,001,946 V198E probably damaging Het
Ank2 T A 3: 126,937,785 H658L possibly damaging Het
Atp8b5 T A 4: 43,366,072 I781N probably damaging Het
Bloc1s6 A T 2: 122,742,645 R47* probably null Het
Clk2 G A 3: 89,173,504 V266M probably damaging Het
Cul9 A C 17: 46,530,014 Y777D probably damaging Het
Dcp1a C T 14: 30,479,598 probably benign Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Dnajb2 T G 1: 75,243,582 D248E Het
Dpy19l1 T C 9: 24,502,895 H79R probably benign Het
Elmo1 T C 13: 20,600,201 S643P probably damaging Het
Fam76b T C 9: 13,831,102 C110R probably damaging Het
Galnt7 T A 8: 57,538,188 K429N probably benign Het
Gm10142 T A 10: 77,716,116 C104S probably damaging Het
Gm7298 A C 6: 121,787,443 H1427P probably benign Het
Golga7b A T 19: 42,266,871 I87F probably damaging Het
Gpr165 C A X: 96,714,017 D7E probably benign Het
Gpr25 C A 1: 136,260,677 R66L probably benign Het
H2-Q2 A G 17: 35,344,865 N241D probably benign Het
Il1a T C 2: 129,302,961 D179G probably benign Het
Itch T C 2: 155,206,383 probably null Het
Itsn2 T C 12: 4,662,052 V913A probably benign Het
Kdm1b T A 13: 47,071,878 probably benign Het
Lama4 T C 10: 39,061,379 I655T possibly damaging Het
Lats1 T A 10: 7,705,903 S817R probably damaging Het
Lrrc8c A T 5: 105,607,867 M503L probably benign Het
Mast4 T C 13: 102,738,721 T1380A probably damaging Het
Mfap1a G T 2: 121,506,495 T16K possibly damaging Het
Mroh2b C T 15: 4,931,104 T773I probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nudt7 A G 8: 114,151,997 Y255C probably benign Het
Pfas T C 11: 69,000,263 T310A probably damaging Het
Pkhd1l1 T G 15: 44,543,546 I2393R probably damaging Het
Pmm1 A C 15: 81,960,731 L24R possibly damaging Het
Pram1 T C 17: 33,641,164 V235A probably benign Het
Prg4 T C 1: 150,455,126 T599A unknown Het
Prpf40b A G 15: 99,316,285 K812E unknown Het
Qars G A 9: 108,509,452 A155T probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rgs6 A G 12: 83,137,704 probably benign Het
Rom1 T A 19: 8,928,681 R165W probably damaging Het
Rps6kb2 T A 19: 4,156,988 probably benign Het
Ryr1 A T 7: 29,069,121 W2808R probably damaging Het
Sh3gl1 A G 17: 56,019,038 probably null Het
Slc22a30 A T 19: 8,370,199 M279K probably benign Het
Snx11 A G 11: 96,769,933 S184P unknown Het
Srgap1 A G 10: 121,804,817 C692R probably damaging Het
Srgap3 T C 6: 112,723,143 N982S probably damaging Het
Stac T A 9: 111,593,745 D270V probably benign Het
Syn3 T A 10: 86,135,021 I246F probably benign Het
Tnr T C 1: 159,892,093 V980A probably damaging Het
Usp17le G T 7: 104,769,794 A47E possibly damaging Het
Vmn2r118 T C 17: 55,610,936 N192S probably benign Het
Zmym4 C A 4: 126,905,369 V725L possibly damaging Het
Other mutations in Evi5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01142:Evi5 APN 5 107815611 missense probably benign 0.05
IGL01458:Evi5 APN 5 107815647 missense probably damaging 1.00
IGL01615:Evi5 APN 5 107764707 missense probably damaging 1.00
IGL01939:Evi5 APN 5 107816924 unclassified probably benign
IGL02170:Evi5 APN 5 107821884 missense probably benign 0.45
IGL02539:Evi5 APN 5 107815665 missense probably benign 0.09
IGL02655:Evi5 APN 5 107813580 missense probably benign 0.36
IGL03040:Evi5 APN 5 107821806 missense probably damaging 1.00
IGL03058:Evi5 APN 5 107748151 missense probably damaging 0.98
R0125:Evi5 UTSW 5 107795772 missense probably benign 0.06
R0172:Evi5 UTSW 5 107790462 missense probably benign
R0334:Evi5 UTSW 5 107820535 missense probably damaging 0.97
R0335:Evi5 UTSW 5 107812411 missense probably benign 0.06
R0526:Evi5 UTSW 5 107821748 missense probably benign 0.44
R0579:Evi5 UTSW 5 107821709 missense probably benign 0.36
R0585:Evi5 UTSW 5 107813536 unclassified probably benign
R1123:Evi5 UTSW 5 107820578 missense probably benign 0.02
R1618:Evi5 UTSW 5 107799118 splice site probably benign
R1699:Evi5 UTSW 5 107818920 missense probably damaging 1.00
R1772:Evi5 UTSW 5 107795841 missense probably benign 0.32
R1969:Evi5 UTSW 5 107748364 missense probably benign 0.04
R1977:Evi5 UTSW 5 107799139 nonsense probably null
R2010:Evi5 UTSW 5 107813545 critical splice donor site probably null
R3736:Evi5 UTSW 5 107818983 missense probably damaging 0.98
R5047:Evi5 UTSW 5 107821874 missense probably damaging 1.00
R5252:Evi5 UTSW 5 107795752 missense probably benign
R5350:Evi5 UTSW 5 107815678 missense probably benign 0.08
R5552:Evi5 UTSW 5 107818989 missense probably damaging 1.00
R5594:Evi5 UTSW 5 107820451 missense possibly damaging 0.84
R5895:Evi5 UTSW 5 107820436 missense probably damaging 1.00
R6334:Evi5 UTSW 5 107820521 nonsense probably null
R6364:Evi5 UTSW 5 107842113 missense probably damaging 1.00
R6838:Evi5 UTSW 5 107842161 missense possibly damaging 0.94
R6861:Evi5 UTSW 5 107748318 missense probably benign 0.00
R7032:Evi5 UTSW 5 107788281 missense probably benign 0.14
R7386:Evi5 UTSW 5 107809823 splice site probably null
R7844:Evi5 UTSW 5 107874994 missense probably benign 0.00
R8298:Evi5 UTSW 5 107816865 missense possibly damaging 0.53
X0018:Evi5 UTSW 5 107818887 critical splice donor site probably null
X0027:Evi5 UTSW 5 107764762 missense probably damaging 0.98
Z1177:Evi5 UTSW 5 107748379 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTTAAACTGACCAGCAAGTCATC -3'
(R):5'- AGTACCACGTGTGCTCAGAG -3'

Sequencing Primer
(F):5'- GCATCTGAGCCTCTAGAACAAGG -3'
(R):5'- GCCAGAAGAAGAGGCTTTT -3'
Posted On2020-07-28