Incidental Mutation 'R0095:Bicc1'
ID64037
Institutional Source Beutler Lab
Gene Symbol Bicc1
Ensembl Gene ENSMUSG00000014329
Gene NameBicC family RNA binding protein 1
SynonymsBic-C, jcpk
MMRRC Submission 038381-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0095 (G1)
Quality Score93
Status Not validated
Chromosome10
Chromosomal Location70922832-71159700 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 70961158 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 42 (I42F)
Ref Sequence ENSEMBL: ENSMUSP00000119137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014473] [ENSMUST00000131445] [ENSMUST00000143791]
Predicted Effect probably damaging
Transcript: ENSMUST00000014473
AA Change: I124F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000014473
Gene: ENSMUSG00000014329
AA Change: I124F

DomainStartEndE-ValueType
KH 47 129 2.69e0 SMART
KH 133 206 6.24e-18 SMART
KH 285 355 1.25e-8 SMART
low complexity region 384 402 N/A INTRINSIC
low complexity region 447 467 N/A INTRINSIC
low complexity region 480 499 N/A INTRINSIC
low complexity region 700 718 N/A INTRINSIC
low complexity region 736 747 N/A INTRINSIC
low complexity region 794 815 N/A INTRINSIC
SAM 872 938 2.04e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000131445
AA Change: I42F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119137
Gene: ENSMUSG00000014329
AA Change: I42F

DomainStartEndE-ValueType
SCOP:d1dtja_ 1 46 1e-2 SMART
Blast:KH 1 47 1e-22 BLAST
KH 51 124 6.24e-18 SMART
KH 203 273 1.25e-8 SMART
low complexity region 302 320 N/A INTRINSIC
low complexity region 365 385 N/A INTRINSIC
low complexity region 398 417 N/A INTRINSIC
low complexity region 618 636 N/A INTRINSIC
low complexity region 654 665 N/A INTRINSIC
low complexity region 712 733 N/A INTRINSIC
SAM 790 856 2.04e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000143791
AA Change: I124F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000123201
Gene: ENSMUSG00000014329
AA Change: I124F

DomainStartEndE-ValueType
KH 47 129 2.69e0 SMART
KH 133 206 6.24e-18 SMART
KH 285 355 1.25e-8 SMART
low complexity region 384 402 N/A INTRINSIC
low complexity region 447 467 N/A INTRINSIC
low complexity region 480 499 N/A INTRINSIC
low complexity region 700 718 N/A INTRINSIC
low complexity region 736 747 N/A INTRINSIC
low complexity region 794 815 N/A INTRINSIC
SAM 872 938 4.26e-12 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding protein that is active in regulating gene expression by modulating protein translation during embryonic development. Mouse studies identified the corresponding protein to be under strict control during cell differentiation and to be a maternally provided gene product. [provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygous inactivation of this gene causes heteroxia, impaired nodal flow, ventricular septal defects, partial prenatal lethality and postnatal death due to renal failure. Chemically induced mutants develop kidney cysts and may show bulging abdomens, bile duct anomalies and cardiovascular defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anxa8 G A 14: 34,086,071 A6T probably benign Het
Cutc T C 19: 43,753,199 W13R probably benign Het
F5 A T 1: 164,191,968 R671* probably null Het
Fam84b T C 15: 60,823,576 Y107C probably damaging Het
Fer A T 17: 63,941,326 E361V possibly damaging Het
Hnrnpa3 G T 2: 75,661,696 R52L probably damaging Het
Igsf10 A T 3: 59,331,196 Y521* probably null Het
Mmp1a G A 9: 7,465,620 G186D possibly damaging Het
Naip1 T C 13: 100,423,083 T1138A probably benign Het
Necab1 T A 4: 14,960,027 N307Y possibly damaging Het
Olfr510 A C 7: 108,668,045 I210L probably benign Het
Plekha5 T C 6: 140,528,597 F84L probably damaging Het
Rpl6 T G 5: 121,205,839 V115G possibly damaging Het
Sec16a A T 2: 26,425,760 probably null Het
Tpsg1 T C 17: 25,372,554 W43R probably damaging Het
Unc45a T C 7: 80,329,543 D567G probably damaging Het
Usp30 T A 5: 114,105,840 F157I probably damaging Het
Zfp345 T A 2: 150,472,300 H439L probably damaging Het
Other mutations in Bicc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00961:Bicc1 APN 10 70961157 missense probably damaging 1.00
IGL01988:Bicc1 APN 10 70956176 missense probably damaging 1.00
IGL02686:Bicc1 APN 10 70943360 splice site probably benign
IGL02829:Bicc1 APN 10 70958880 missense probably damaging 1.00
IGL03276:Bicc1 APN 10 70953438 missense possibly damaging 0.76
IGL03354:Bicc1 APN 10 70946602 missense probably benign 0.00
artemis UTSW 10 71027954 missense probably damaging 0.99
Pebbles UTSW 10 70947900 missense possibly damaging 0.95
PIT1430001:Bicc1 UTSW 10 70957681 missense possibly damaging 0.94
R0142:Bicc1 UTSW 10 70925370 missense probably damaging 1.00
R0184:Bicc1 UTSW 10 71079215 missense probably benign
R0469:Bicc1 UTSW 10 71079215 missense probably benign
R0485:Bicc1 UTSW 10 70925315 missense probably damaging 0.96
R0520:Bicc1 UTSW 10 70957190 missense probably damaging 0.96
R0884:Bicc1 UTSW 10 70958847 missense probably damaging 1.00
R1678:Bicc1 UTSW 10 70943518 missense probably damaging 1.00
R1892:Bicc1 UTSW 10 70958784 missense probably damaging 1.00
R1943:Bicc1 UTSW 10 71159523 missense probably damaging 1.00
R2220:Bicc1 UTSW 10 70950125 missense probably damaging 1.00
R2240:Bicc1 UTSW 10 70946803 critical splice donor site probably null
R2519:Bicc1 UTSW 10 70930644 missense probably damaging 1.00
R4362:Bicc1 UTSW 10 70943374 frame shift probably null
R4363:Bicc1 UTSW 10 70943374 frame shift probably null
R4419:Bicc1 UTSW 10 70946974 missense possibly damaging 0.73
R4697:Bicc1 UTSW 10 70953484 missense possibly damaging 0.87
R4728:Bicc1 UTSW 10 70935831 critical splice donor site probably null
R4765:Bicc1 UTSW 10 70940593 missense probably damaging 1.00
R4838:Bicc1 UTSW 10 70945316 missense possibly damaging 0.50
R5022:Bicc1 UTSW 10 70947883 missense possibly damaging 0.79
R5023:Bicc1 UTSW 10 70947883 missense possibly damaging 0.79
R5057:Bicc1 UTSW 10 70947883 missense possibly damaging 0.79
R5082:Bicc1 UTSW 10 70940522 missense probably benign 0.05
R5160:Bicc1 UTSW 10 70932236 missense probably damaging 1.00
R5294:Bicc1 UTSW 10 70947900 missense possibly damaging 0.95
R5639:Bicc1 UTSW 10 70940520 missense probably damaging 1.00
R5749:Bicc1 UTSW 10 70946969 missense probably benign 0.00
R6045:Bicc1 UTSW 10 70957081 nonsense probably null
R6128:Bicc1 UTSW 10 70940483 splice site probably null
R6277:Bicc1 UTSW 10 71027901 missense possibly damaging 0.74
R6389:Bicc1 UTSW 10 70958922 missense probably damaging 1.00
R7021:Bicc1 UTSW 10 70961148 missense probably damaging 0.99
R7101:Bicc1 UTSW 10 70930653 missense probably damaging 1.00
R7351:Bicc1 UTSW 10 70947900 missense probably benign 0.18
R7352:Bicc1 UTSW 10 70947900 missense probably benign 0.18
R7353:Bicc1 UTSW 10 70947900 missense probably benign 0.18
R7366:Bicc1 UTSW 10 70943386 missense probably benign 0.01
R7480:Bicc1 UTSW 10 70943476 missense probably damaging 1.00
R7541:Bicc1 UTSW 10 70946604 missense possibly damaging 0.82
R7544:Bicc1 UTSW 10 70956374 missense possibly damaging 0.89
R7555:Bicc1 UTSW 10 70956291 missense possibly damaging 0.75
R7663:Bicc1 UTSW 10 70946590 missense probably benign
R7671:Bicc1 UTSW 10 70957167 missense probably benign 0.01
R7747:Bicc1 UTSW 10 70946993 missense probably benign
RF013:Bicc1 UTSW 10 70935830 critical splice donor site probably null
X0028:Bicc1 UTSW 10 70945336 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTAGCACTAACAAGGGCCAATGTATC -3'
(R):5'- TGCTCATCCAATTTTCAGAAGAGGGG -3'

Sequencing Primer
(F):5'- CAAGGGCCAATGTATCTTTCTG -3'
(R):5'- TGATCGCATATACACAGTGCAG -3'
Posted On2013-08-06