Incidental Mutation 'R8248:Srgap3'
ID640370
Institutional Source Beutler Lab
Gene Symbol Srgap3
Ensembl Gene ENSMUSG00000030257
Gene NameSLIT-ROBO Rho GTPase activating protein 3
SynonymsD130026O08Rik, Arhgap14
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock #R8248 (G1)
Quality Score191.009
Status Validated
Chromosome6
Chromosomal Location112717971-112947266 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112723143 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 982 (N982S)
Ref Sequence ENSEMBL: ENSMUSP00000085712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088373] [ENSMUST00000113169]
Predicted Effect probably damaging
Transcript: ENSMUST00000088373
AA Change: N982S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000085712
Gene: ENSMUSG00000030257
AA Change: N982S

DomainStartEndE-ValueType
FCH 22 120 3.81e-16 SMART
low complexity region 172 190 N/A INTRINSIC
coiled coil region 353 392 N/A INTRINSIC
low complexity region 484 495 N/A INTRINSIC
RhoGAP 517 691 7.43e-66 SMART
SH3 747 802 9.69e-15 SMART
coiled coil region 955 985 N/A INTRINSIC
low complexity region 1025 1038 N/A INTRINSIC
low complexity region 1053 1064 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113169
AA Change: N958S

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108794
Gene: ENSMUSG00000030257
AA Change: N958S

DomainStartEndE-ValueType
FCH 22 120 3.81e-16 SMART
low complexity region 172 190 N/A INTRINSIC
coiled coil region 353 392 N/A INTRINSIC
Blast:RhoGAP 434 474 4e-11 BLAST
low complexity region 476 488 N/A INTRINSIC
RhoGAP 493 667 7.43e-66 SMART
SH3 723 778 9.69e-15 SMART
coiled coil region 931 961 N/A INTRINSIC
low complexity region 1001 1014 N/A INTRINSIC
low complexity region 1029 1040 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (60/60)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit a reduction in spine density in the brain CA1 and cortical layers IV/V. Mice homozygous for a different knock-out allele exhibit a neurodevelopment disorder with schizophrenia-related intermediate phenotypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930003A15Rik T C 16: 19,883,806 D24G noncoding transcript Het
Adam32 A G 8: 24,901,470 S343P possibly damaging Het
Agbl2 G A 2: 90,797,564 G238R probably damaging Het
Ahi1 T A 10: 20,972,092 D466E probably benign Het
Ahnak T A 19: 9,001,946 V198E probably damaging Het
Ank2 T A 3: 126,937,785 H658L possibly damaging Het
Atp8b5 T A 4: 43,366,072 I781N probably damaging Het
Bloc1s6 A T 2: 122,742,645 R47* probably null Het
Clk2 G A 3: 89,173,504 V266M probably damaging Het
Cul9 A C 17: 46,530,014 Y777D probably damaging Het
Dcp1a C T 14: 30,479,598 probably benign Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Dnajb2 T G 1: 75,243,582 D248E Het
Dpy19l1 T C 9: 24,502,895 H79R probably benign Het
Elmo1 T C 13: 20,600,201 S643P probably damaging Het
Evi5 A G 5: 107,818,887 probably null Het
Fam76b T C 9: 13,831,102 C110R probably damaging Het
Galnt7 T A 8: 57,538,188 K429N probably benign Het
Gm10142 T A 10: 77,716,116 C104S probably damaging Het
Gm7298 A C 6: 121,787,443 H1427P probably benign Het
Golga7b A T 19: 42,266,871 I87F probably damaging Het
Gpr165 C A X: 96,714,017 D7E probably benign Het
Gpr25 C A 1: 136,260,677 R66L probably benign Het
H2-Q2 A G 17: 35,344,865 N241D probably benign Het
Il1a T C 2: 129,302,961 D179G probably benign Het
Itch T C 2: 155,206,383 probably null Het
Itsn2 T C 12: 4,662,052 V913A probably benign Het
Kdm1b T A 13: 47,071,878 probably benign Het
Lama4 T C 10: 39,061,379 I655T possibly damaging Het
Lats1 T A 10: 7,705,903 S817R probably damaging Het
Lrrc8c A T 5: 105,607,867 M503L probably benign Het
Mast4 T C 13: 102,738,721 T1380A probably damaging Het
Mfap1a G T 2: 121,506,495 T16K possibly damaging Het
Mroh2b C T 15: 4,931,104 T773I probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nudt7 A G 8: 114,151,997 Y255C probably benign Het
Pfas T C 11: 69,000,263 T310A probably damaging Het
Pkhd1l1 T G 15: 44,543,546 I2393R probably damaging Het
Pmm1 A C 15: 81,960,731 L24R possibly damaging Het
Pram1 T C 17: 33,641,164 V235A probably benign Het
Prg4 T C 1: 150,455,126 T599A unknown Het
Prpf40b A G 15: 99,316,285 K812E unknown Het
Qars G A 9: 108,509,452 A155T probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rgs6 A G 12: 83,137,704 probably benign Het
Rom1 T A 19: 8,928,681 R165W probably damaging Het
Rps6kb2 T A 19: 4,156,988 probably benign Het
Ryr1 A T 7: 29,069,121 W2808R probably damaging Het
Sh3gl1 A G 17: 56,019,038 probably null Het
Slc22a30 A T 19: 8,370,199 M279K probably benign Het
Snx11 A G 11: 96,769,933 S184P unknown Het
Srgap1 A G 10: 121,804,817 C692R probably damaging Het
Stac T A 9: 111,593,745 D270V probably benign Het
Syn3 T A 10: 86,135,021 I246F probably benign Het
Tnr T C 1: 159,892,093 V980A probably damaging Het
Usp17le G T 7: 104,769,794 A47E possibly damaging Het
Vmn2r118 T C 17: 55,610,936 N192S probably benign Het
Zmym4 C A 4: 126,905,369 V725L possibly damaging Het
Other mutations in Srgap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:Srgap3 APN 6 112739397 missense probably damaging 0.98
IGL01325:Srgap3 APN 6 112775686 missense probably damaging 1.00
IGL01608:Srgap3 APN 6 112946478 missense probably benign 0.00
IGL01626:Srgap3 APN 6 112773648 missense probably damaging 0.98
IGL01787:Srgap3 APN 6 112723022 missense probably benign 0.00
IGL02698:Srgap3 APN 6 112746928 missense probably damaging 0.98
IGL02805:Srgap3 APN 6 112727263 missense probably damaging 0.99
IGL02813:Srgap3 APN 6 112731480 missense probably damaging 1.00
IGL02876:Srgap3 APN 6 112771453 missense probably damaging 1.00
IGL03264:Srgap3 APN 6 112816675 missense probably damaging 1.00
IGL03342:Srgap3 APN 6 112775687 missense probably damaging 1.00
R0007:Srgap3 UTSW 6 112829512 missense probably damaging 1.00
R0371:Srgap3 UTSW 6 112771471 missense probably damaging 0.99
R0607:Srgap3 UTSW 6 112723119 missense probably damaging 1.00
R1628:Srgap3 UTSW 6 112739370 missense probably damaging 0.99
R1669:Srgap3 UTSW 6 112722904 missense probably benign 0.36
R1858:Srgap3 UTSW 6 112771518 missense probably damaging 1.00
R1876:Srgap3 UTSW 6 112775566 missense probably damaging 0.98
R1896:Srgap3 UTSW 6 112738997 missense probably benign 0.11
R2159:Srgap3 UTSW 6 112771378 missense probably damaging 0.99
R2221:Srgap3 UTSW 6 112946493 missense probably damaging 0.98
R2862:Srgap3 UTSW 6 112722972 missense probably damaging 0.99
R3160:Srgap3 UTSW 6 112729658 missense probably benign 0.00
R3162:Srgap3 UTSW 6 112729658 missense probably benign 0.00
R4092:Srgap3 UTSW 6 112723084 missense probably benign 0.00
R4561:Srgap3 UTSW 6 112781054 missense probably damaging 0.98
R4781:Srgap3 UTSW 6 112757425 intron probably benign
R4825:Srgap3 UTSW 6 112727310 missense probably benign
R4887:Srgap3 UTSW 6 112746934 missense probably damaging 1.00
R5304:Srgap3 UTSW 6 112766939 missense probably damaging 1.00
R5556:Srgap3 UTSW 6 112739078 missense probably damaging 0.99
R5672:Srgap3 UTSW 6 112775561 missense probably benign
R5879:Srgap3 UTSW 6 112722846 missense possibly damaging 0.67
R5944:Srgap3 UTSW 6 112795814 missense possibly damaging 0.89
R6277:Srgap3 UTSW 6 112739383 missense probably benign 0.02
R6298:Srgap3 UTSW 6 112816610 missense probably damaging 0.98
R6407:Srgap3 UTSW 6 112723006 missense probably damaging 0.99
R6408:Srgap3 UTSW 6 112723006 missense probably damaging 0.99
R6797:Srgap3 UTSW 6 112829542 missense probably damaging 1.00
R6852:Srgap3 UTSW 6 112816661 missense probably damaging 1.00
R6965:Srgap3 UTSW 6 112723129 missense probably damaging 1.00
R7055:Srgap3 UTSW 6 112746963 missense probably damaging 0.97
R7067:Srgap3 UTSW 6 112757305 intron probably benign
R7361:Srgap3 UTSW 6 112746921 missense probably damaging 0.99
R7479:Srgap3 UTSW 6 112735833 critical splice donor site probably null
R7606:Srgap3 UTSW 6 112739376 missense probably benign 0.00
R7731:Srgap3 UTSW 6 112766897 missense probably benign 0.36
R7787:Srgap3 UTSW 6 112775559 missense probably benign 0.02
R7934:Srgap3 UTSW 6 112731489 missense probably damaging 1.00
R8026:Srgap3 UTSW 6 112739364 missense probably benign 0.00
R8040:Srgap3 UTSW 6 112739364 missense probably benign 0.00
R8066:Srgap3 UTSW 6 112771378 missense probably damaging 0.99
R8067:Srgap3 UTSW 6 112739364 missense probably benign 0.00
R8090:Srgap3 UTSW 6 112781035 nonsense probably null
R8151:Srgap3 UTSW 6 112816667 missense probably damaging 1.00
R8365:Srgap3 UTSW 6 112816734 missense probably damaging 1.00
R8369:Srgap3 UTSW 6 112722818 missense probably benign
R8444:Srgap3 UTSW 6 112775548 missense possibly damaging 0.56
R8509:Srgap3 UTSW 6 112731336 nonsense probably null
X0062:Srgap3 UTSW 6 112795786 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGAAGGTGGTCATCATCTCCG -3'
(R):5'- ACAGGGAATGAATGCTCGC -3'

Sequencing Primer
(F):5'- ATCTCCGTCGATGAGCTGCTG -3'
(R):5'- CCCTGAGTTGGTTGCAAGAC -3'
Posted On2020-07-28