Incidental Mutation 'R8248:Ryr1'
ID640372
Institutional Source Beutler Lab
Gene Symbol Ryr1
Ensembl Gene ENSMUSG00000030592
Gene Nameryanodine receptor 1, skeletal muscle
Synonymsskrr, calcium release channel isoform 1, Ryr
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8248 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location29003344-29125179 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 29069121 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 2808 (W2808R)
Ref Sequence ENSEMBL: ENSMUSP00000137123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032813] [ENSMUST00000179893]
Predicted Effect probably damaging
Transcript: ENSMUST00000032813
AA Change: W2808R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032813
Gene: ENSMUSG00000030592
AA Change: W2808R

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
MIR 99 154 7.52e-4 SMART
MIR 161 206 1.11e-6 SMART
MIR 212 266 1.23e-8 SMART
MIR 272 362 1.05e-25 SMART
Pfam:RYDR_ITPR 441 645 1.2e-73 PFAM
SPRY 660 798 2.79e-27 SMART
Pfam:RyR 851 945 6.5e-33 PFAM
Pfam:RyR 965 1059 1.5e-30 PFAM
SPRY 1086 1209 8.62e-42 SMART
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1340 1349 N/A INTRINSIC
SPRY 1431 1571 3.05e-33 SMART
low complexity region 1787 1798 N/A INTRINSIC
coiled coil region 1871 1932 N/A INTRINSIC
low complexity region 1989 1998 N/A INTRINSIC
low complexity region 2048 2057 N/A INTRINSIC
low complexity region 2069 2092 N/A INTRINSIC
Pfam:RYDR_ITPR 2158 2366 7e-66 PFAM
low complexity region 2390 2404 N/A INTRINSIC
Pfam:RyR 2735 2829 9.7e-34 PFAM
Pfam:RyR 2855 2943 5.7e-32 PFAM
low complexity region 3130 3144 N/A INTRINSIC
low complexity region 3290 3304 N/A INTRINSIC
low complexity region 3375 3394 N/A INTRINSIC
PDB:2BCX|B 3613 3642 2e-13 PDB
low complexity region 3681 3691 N/A INTRINSIC
low complexity region 3735 3760 N/A INTRINSIC
Pfam:RIH_assoc 3872 4004 1.9e-41 PFAM
low complexity region 4010 4023 N/A INTRINSIC
Pfam:EF-hand_8 4085 4136 9.8e-8 PFAM
transmembrane domain 4283 4305 N/A INTRINSIC
transmembrane domain 4318 4336 N/A INTRINSIC
transmembrane domain 4341 4363 N/A INTRINSIC
Pfam:RR_TM4-6 4377 4666 2e-86 PFAM
Pfam:Ion_trans 4761 4932 3.4e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000179893
AA Change: W2808R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000137123
Gene: ENSMUSG00000030592
AA Change: W2808R

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
MIR 99 154 7.52e-4 SMART
MIR 161 206 1.11e-6 SMART
MIR 212 266 1.23e-8 SMART
MIR 272 362 1.05e-25 SMART
Pfam:RYDR_ITPR 443 638 4.5e-63 PFAM
SPRY 660 798 2.79e-27 SMART
Pfam:RyR 852 942 1.3e-37 PFAM
Pfam:RyR 966 1056 1.6e-28 PFAM
SPRY 1086 1209 8.62e-42 SMART
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1340 1349 N/A INTRINSIC
SPRY 1431 1571 3.05e-33 SMART
low complexity region 1787 1798 N/A INTRINSIC
coiled coil region 1871 1932 N/A INTRINSIC
low complexity region 1989 1998 N/A INTRINSIC
low complexity region 2048 2057 N/A INTRINSIC
low complexity region 2069 2092 N/A INTRINSIC
Pfam:RYDR_ITPR 2160 2366 2.2e-68 PFAM
low complexity region 2390 2404 N/A INTRINSIC
Pfam:RyR 2736 2826 7.2e-31 PFAM
Pfam:RyR 2856 2940 5.6e-27 PFAM
low complexity region 3130 3144 N/A INTRINSIC
low complexity region 3290 3304 N/A INTRINSIC
low complexity region 3375 3394 N/A INTRINSIC
PDB:2BCX|B 3615 3644 2e-13 PDB
low complexity region 3683 3693 N/A INTRINSIC
low complexity region 3737 3762 N/A INTRINSIC
Pfam:RIH_assoc 3878 3996 6.2e-35 PFAM
low complexity region 4012 4025 N/A INTRINSIC
Pfam:EF-hand_8 4087 4137 1.8e-8 PFAM
transmembrane domain 4285 4307 N/A INTRINSIC
transmembrane domain 4320 4338 N/A INTRINSIC
transmembrane domain 4343 4365 N/A INTRINSIC
Pfam:RR_TM4-6 4379 4668 8.4e-76 PFAM
Pfam:Ion_trans 4763 4946 2.8e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ryanodine receptor found in skeletal muscle. The encoded protein functions as a calcium release channel in the sarcoplasmic reticulum but also serves to connect the sarcoplasmic reticulum and transverse tubule. Mutations in this gene are associated with malignant hyperthermia susceptibility, central core disease, and minicore myopathy with external ophthalmoplegia. Alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation and a similar ENU-induced mutation are born with a rounded body shape, edema, thin and misshapened ribs, and abnormal muscle fibers. Mutants die perinatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930003A15Rik T C 16: 19,883,806 D24G noncoding transcript Het
Adam32 A G 8: 24,901,470 S343P possibly damaging Het
Agbl2 G A 2: 90,797,564 G238R probably damaging Het
Ahi1 T A 10: 20,972,092 D466E probably benign Het
Ahnak T A 19: 9,001,946 V198E probably damaging Het
Ank2 T A 3: 126,937,785 H658L possibly damaging Het
Atp8b5 T A 4: 43,366,072 I781N probably damaging Het
Bloc1s6 A T 2: 122,742,645 R47* probably null Het
Clk2 G A 3: 89,173,504 V266M probably damaging Het
Cul9 A C 17: 46,530,014 Y777D probably damaging Het
Dcp1a C T 14: 30,479,598 probably benign Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Dnajb2 T G 1: 75,243,582 D248E Het
Dpy19l1 T C 9: 24,502,895 H79R probably benign Het
Elmo1 T C 13: 20,600,201 S643P probably damaging Het
Evi5 A G 5: 107,818,887 probably null Het
Fam76b T C 9: 13,831,102 C110R probably damaging Het
Galnt7 T A 8: 57,538,188 K429N probably benign Het
Gm10142 T A 10: 77,716,116 C104S probably damaging Het
Gm7298 A C 6: 121,787,443 H1427P probably benign Het
Golga7b A T 19: 42,266,871 I87F probably damaging Het
Gpr165 C A X: 96,714,017 D7E probably benign Het
Gpr25 C A 1: 136,260,677 R66L probably benign Het
H2-Q2 A G 17: 35,344,865 N241D probably benign Het
Il1a T C 2: 129,302,961 D179G probably benign Het
Itch T C 2: 155,206,383 probably null Het
Itsn2 T C 12: 4,662,052 V913A probably benign Het
Kdm1b T A 13: 47,071,878 probably benign Het
Lama4 T C 10: 39,061,379 I655T possibly damaging Het
Lats1 T A 10: 7,705,903 S817R probably damaging Het
Lrrc8c A T 5: 105,607,867 M503L probably benign Het
Mast4 T C 13: 102,738,721 T1380A probably damaging Het
Mfap1a G T 2: 121,506,495 T16K possibly damaging Het
Mroh2b C T 15: 4,931,104 T773I probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nudt7 A G 8: 114,151,997 Y255C probably benign Het
Pfas T C 11: 69,000,263 T310A probably damaging Het
Pkhd1l1 T G 15: 44,543,546 I2393R probably damaging Het
Pmm1 A C 15: 81,960,731 L24R possibly damaging Het
Pram1 T C 17: 33,641,164 V235A probably benign Het
Prg4 T C 1: 150,455,126 T599A unknown Het
Prpf40b A G 15: 99,316,285 K812E unknown Het
Qars G A 9: 108,509,452 A155T probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rgs6 A G 12: 83,137,704 probably benign Het
Rom1 T A 19: 8,928,681 R165W probably damaging Het
Rps6kb2 T A 19: 4,156,988 probably benign Het
Sh3gl1 A G 17: 56,019,038 probably null Het
Slc22a30 A T 19: 8,370,199 M279K probably benign Het
Snx11 A G 11: 96,769,933 S184P unknown Het
Srgap1 A G 10: 121,804,817 C692R probably damaging Het
Srgap3 T C 6: 112,723,143 N982S probably damaging Het
Stac T A 9: 111,593,745 D270V probably benign Het
Syn3 T A 10: 86,135,021 I246F probably benign Het
Tnr T C 1: 159,892,093 V980A probably damaging Het
Usp17le G T 7: 104,769,794 A47E possibly damaging Het
Vmn2r118 T C 17: 55,610,936 N192S probably benign Het
Zmym4 C A 4: 126,905,369 V725L possibly damaging Het
Other mutations in Ryr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Ryr1 APN 7 29102810 missense probably damaging 1.00
IGL00335:Ryr1 APN 7 29124960 splice site probably null
IGL00427:Ryr1 APN 7 29104737 splice site probably benign
IGL00559:Ryr1 APN 7 29012242 splice site probably benign
IGL00803:Ryr1 APN 7 29069645 missense possibly damaging 0.95
IGL00886:Ryr1 APN 7 29024229 missense probably damaging 1.00
IGL00948:Ryr1 APN 7 29020195 missense possibly damaging 0.78
IGL01017:Ryr1 APN 7 29082543 missense probably damaging 0.99
IGL01116:Ryr1 APN 7 29100202 splice site probably benign
IGL01385:Ryr1 APN 7 29056985 missense probably damaging 1.00
IGL01482:Ryr1 APN 7 29052337 missense probably damaging 1.00
IGL01529:Ryr1 APN 7 29075227 missense probably damaging 1.00
IGL01543:Ryr1 APN 7 29091076 missense probably damaging 1.00
IGL01653:Ryr1 APN 7 29078597 missense probably damaging 0.99
IGL01701:Ryr1 APN 7 29059810 missense probably damaging 0.98
IGL02051:Ryr1 APN 7 29071658 missense probably benign 0.16
IGL02152:Ryr1 APN 7 29052015 missense possibly damaging 0.95
IGL02271:Ryr1 APN 7 29094047 missense probably benign 0.07
IGL02321:Ryr1 APN 7 29078696 missense probably damaging 1.00
IGL02448:Ryr1 APN 7 29105066 splice site probably benign
IGL02472:Ryr1 APN 7 29040844 missense probably damaging 1.00
IGL02544:Ryr1 APN 7 29115599 missense probably benign 0.24
IGL02666:Ryr1 APN 7 29019763 missense unknown
IGL02672:Ryr1 APN 7 29004519 unclassified probably benign
IGL02677:Ryr1 APN 7 29110608 missense probably benign 0.18
IGL02686:Ryr1 APN 7 29069550 splice site probably benign
IGL02751:Ryr1 APN 7 29078774 missense probably damaging 1.00
IGL02899:Ryr1 APN 7 29048795 missense possibly damaging 0.53
IGL02926:Ryr1 APN 7 29061540 missense probably damaging 1.00
IGL02950:Ryr1 APN 7 29097459 missense probably damaging 1.00
IGL02960:Ryr1 APN 7 29060053 missense probably damaging 1.00
IGL02968:Ryr1 APN 7 29043893 missense probably damaging 1.00
IGL03070:Ryr1 APN 7 29070659 missense probably damaging 1.00
IGL03091:Ryr1 APN 7 29083486 missense possibly damaging 0.85
IGL03100:Ryr1 APN 7 29104593 missense probably damaging 1.00
IGL03107:Ryr1 APN 7 29075199 missense probably damaging 1.00
IGL03117:Ryr1 APN 7 29102964 missense probably damaging 1.00
IGL03118:Ryr1 APN 7 29015786 missense unknown
IGL03146:Ryr1 APN 7 29094032 missense probably benign 0.09
IGL03165:Ryr1 APN 7 29105040 missense probably benign 0.22
IGL03220:Ryr1 APN 7 29059855 missense probably damaging 1.00
R0017:Ryr1 UTSW 7 29047542 missense probably damaging 1.00
R0066:Ryr1 UTSW 7 29005567 unclassified probably benign
R0066:Ryr1 UTSW 7 29005567 unclassified probably benign
R0069:Ryr1 UTSW 7 29110505 splice site probably benign
R0148:Ryr1 UTSW 7 29052035 missense probably damaging 0.99
R0266:Ryr1 UTSW 7 29040679 missense probably damaging 1.00
R0346:Ryr1 UTSW 7 29067588 splice site probably benign
R0387:Ryr1 UTSW 7 29083367 splice site probably benign
R0454:Ryr1 UTSW 7 29036075 missense probably damaging 0.99
R0494:Ryr1 UTSW 7 29003793 splice site probably benign
R0533:Ryr1 UTSW 7 29078780 missense probably damaging 1.00
R0585:Ryr1 UTSW 7 29036076 missense probably damaging 1.00
R0591:Ryr1 UTSW 7 29104795 missense possibly damaging 0.68
R0624:Ryr1 UTSW 7 29074609 missense probably damaging 1.00
R0662:Ryr1 UTSW 7 29100189 missense probably damaging 1.00
R0849:Ryr1 UTSW 7 29040679 missense probably damaging 1.00
R0961:Ryr1 UTSW 7 29009697 missense unknown
R1052:Ryr1 UTSW 7 29096258 missense probably damaging 0.96
R1218:Ryr1 UTSW 7 29086109 missense possibly damaging 0.79
R1340:Ryr1 UTSW 7 29116012 missense probably damaging 0.99
R1513:Ryr1 UTSW 7 29070621 missense probably damaging 1.00
R1543:Ryr1 UTSW 7 29083537 missense possibly damaging 0.67
R1566:Ryr1 UTSW 7 29092175 missense possibly damaging 0.95
R1572:Ryr1 UTSW 7 29062191 missense probably damaging 1.00
R1623:Ryr1 UTSW 7 29095490 missense probably damaging 1.00
R1632:Ryr1 UTSW 7 29094261 missense probably benign 0.03
R1661:Ryr1 UTSW 7 29101738 missense probably damaging 0.98
R1665:Ryr1 UTSW 7 29036078 missense probably damaging 1.00
R1678:Ryr1 UTSW 7 29116154 missense probably damaging 0.99
R1705:Ryr1 UTSW 7 29078564 missense probably damaging 1.00
R1712:Ryr1 UTSW 7 29047503 missense probably benign 0.25
R1720:Ryr1 UTSW 7 29101870 missense probably damaging 0.99
R1799:Ryr1 UTSW 7 29067621 missense probably damaging 1.00
R1847:Ryr1 UTSW 7 29079811 missense probably benign 0.43
R1860:Ryr1 UTSW 7 29009552 missense unknown
R1861:Ryr1 UTSW 7 29009552 missense unknown
R1921:Ryr1 UTSW 7 29054944 missense probably damaging 1.00
R1983:Ryr1 UTSW 7 29059472 missense possibly damaging 0.74
R2043:Ryr1 UTSW 7 29059631 missense probably damaging 0.99
R2089:Ryr1 UTSW 7 29086049 missense probably damaging 1.00
R2091:Ryr1 UTSW 7 29086049 missense probably damaging 1.00
R2091:Ryr1 UTSW 7 29086049 missense probably damaging 1.00
R2105:Ryr1 UTSW 7 29090150 missense probably damaging 0.99
R2175:Ryr1 UTSW 7 29068442 missense probably damaging 1.00
R2259:Ryr1 UTSW 7 29019741 missense unknown
R2291:Ryr1 UTSW 7 29098777 missense probably damaging 1.00
R2351:Ryr1 UTSW 7 29075293 missense probably benign 0.18
R2512:Ryr1 UTSW 7 29103542 missense possibly damaging 0.64
R2571:Ryr1 UTSW 7 29009562 missense unknown
R2571:Ryr1 UTSW 7 29036126 missense possibly damaging 0.94
R2885:Ryr1 UTSW 7 29074798 missense probably damaging 0.99
R2886:Ryr1 UTSW 7 29074798 missense probably damaging 0.99
R2889:Ryr1 UTSW 7 29078741 missense possibly damaging 0.76
R3051:Ryr1 UTSW 7 29053090 missense probably damaging 1.00
R3052:Ryr1 UTSW 7 29053090 missense probably damaging 1.00
R3053:Ryr1 UTSW 7 29053090 missense probably damaging 1.00
R3082:Ryr1 UTSW 7 29045646 missense probably damaging 1.00
R3103:Ryr1 UTSW 7 29074948 missense probably damaging 1.00
R3237:Ryr1 UTSW 7 29069650 critical splice acceptor site probably null
R3551:Ryr1 UTSW 7 29056997 missense probably damaging 1.00
R3552:Ryr1 UTSW 7 29056997 missense probably damaging 1.00
R3807:Ryr1 UTSW 7 29020152 missense probably damaging 1.00
R3815:Ryr1 UTSW 7 29072902 missense probably damaging 0.98
R4010:Ryr1 UTSW 7 29095124 missense probably benign 0.41
R4041:Ryr1 UTSW 7 29085931 missense possibly damaging 0.77
R4226:Ryr1 UTSW 7 29062151 nonsense probably null
R4257:Ryr1 UTSW 7 29082450 missense possibly damaging 0.93
R4328:Ryr1 UTSW 7 29083059 missense probably damaging 1.00
R4394:Ryr1 UTSW 7 29094242 missense possibly damaging 0.69
R4485:Ryr1 UTSW 7 29090156 missense probably damaging 0.97
R4550:Ryr1 UTSW 7 29098735 missense probably benign 0.05
R4554:Ryr1 UTSW 7 29105008 missense probably benign 0.03
R4562:Ryr1 UTSW 7 29074580 intron probably benign
R4642:Ryr1 UTSW 7 29086038 missense possibly damaging 0.91
R4669:Ryr1 UTSW 7 29059831 missense probably null 0.99
R4707:Ryr1 UTSW 7 29045662 missense probably damaging 1.00
R4766:Ryr1 UTSW 7 29085833 missense probably damaging 0.96
R4768:Ryr1 UTSW 7 29004821 unclassified probably benign
R4770:Ryr1 UTSW 7 29109282 missense probably damaging 0.99
R4780:Ryr1 UTSW 7 29095097 missense possibly damaging 0.85
R4927:Ryr1 UTSW 7 29019983 missense unknown
R4933:Ryr1 UTSW 7 29104298 missense probably damaging 1.00
R4934:Ryr1 UTSW 7 29068095 missense probably damaging 1.00
R4942:Ryr1 UTSW 7 29069573 missense probably damaging 0.98
R4960:Ryr1 UTSW 7 29078783 missense possibly damaging 0.82
R5007:Ryr1 UTSW 7 29069115 missense probably damaging 1.00
R5011:Ryr1 UTSW 7 29102809 splice site probably null
R5013:Ryr1 UTSW 7 29102809 splice site probably null
R5137:Ryr1 UTSW 7 29101858 missense possibly damaging 0.94
R5167:Ryr1 UTSW 7 29067693 missense probably damaging 1.00
R5239:Ryr1 UTSW 7 29036128 missense probably damaging 1.00
R5291:Ryr1 UTSW 7 29115598 missense probably benign 0.03
R5303:Ryr1 UTSW 7 29068482 missense probably damaging 1.00
R5386:Ryr1 UTSW 7 29117416 missense probably damaging 0.98
R5431:Ryr1 UTSW 7 29109812 missense probably benign 0.39
R5460:Ryr1 UTSW 7 29071961 missense probably damaging 1.00
R5463:Ryr1 UTSW 7 29024023 missense possibly damaging 0.79
R5503:Ryr1 UTSW 7 29069028 missense possibly damaging 0.87
R5541:Ryr1 UTSW 7 29086185 missense probably damaging 1.00
R5573:Ryr1 UTSW 7 29015723 missense unknown
R5575:Ryr1 UTSW 7 29078693 missense possibly damaging 0.77
R5610:Ryr1 UTSW 7 29111974 missense probably benign 0.05
R5658:Ryr1 UTSW 7 29091089 splice site probably null
R5918:Ryr1 UTSW 7 29009152 missense probably benign 0.39
R5926:Ryr1 UTSW 7 29104360 missense probably damaging 1.00
R5938:Ryr1 UTSW 7 29046865 missense probably damaging 1.00
R5939:Ryr1 UTSW 7 29116127 missense probably damaging 0.97
R5947:Ryr1 UTSW 7 29071924 missense probably null 0.98
R5991:Ryr1 UTSW 7 29104610 missense probably damaging 0.99
R5992:Ryr1 UTSW 7 29067637 missense probably damaging 1.00
R5996:Ryr1 UTSW 7 29024241 missense probably benign 0.38
R6075:Ryr1 UTSW 7 29087438 missense probably damaging 1.00
R6091:Ryr1 UTSW 7 29071973 missense probably benign 0.01
R6126:Ryr1 UTSW 7 29076239 missense probably null 1.00
R6147:Ryr1 UTSW 7 29085914 missense possibly damaging 0.88
R6235:Ryr1 UTSW 7 29116181 missense probably benign 0.07
R6279:Ryr1 UTSW 7 29087428 missense possibly damaging 0.93
R6381:Ryr1 UTSW 7 29075257 missense possibly damaging 0.87
R6441:Ryr1 UTSW 7 29059695 missense possibly damaging 0.95
R6443:Ryr1 UTSW 7 29077078 missense probably damaging 0.97
R6459:Ryr1 UTSW 7 29015654 missense probably benign 0.39
R6514:Ryr1 UTSW 7 29046841 missense probably damaging 1.00
R6563:Ryr1 UTSW 7 29095492 missense possibly damaging 0.92
R6660:Ryr1 UTSW 7 29038345 critical splice donor site probably null
R6746:Ryr1 UTSW 7 29117404 missense possibly damaging 0.56
R6785:Ryr1 UTSW 7 29064874 missense probably benign 0.12
R6800:Ryr1 UTSW 7 29024316 missense possibly damaging 0.95
R6939:Ryr1 UTSW 7 29052326 missense possibly damaging 0.91
R6980:Ryr1 UTSW 7 29109387 missense probably benign 0.03
R6995:Ryr1 UTSW 7 29094182 missense probably damaging 0.97
R7065:Ryr1 UTSW 7 29103643 missense probably damaging 1.00
R7123:Ryr1 UTSW 7 29046854 missense probably benign 0.37
R7238:Ryr1 UTSW 7 29095382 missense probably benign 0.24
R7240:Ryr1 UTSW 7 29052015 missense possibly damaging 0.95
R7300:Ryr1 UTSW 7 29059511 missense probably damaging 1.00
R7365:Ryr1 UTSW 7 29085755 missense probably benign 0.05
R7403:Ryr1 UTSW 7 29013867 missense probably benign 0.34
R7422:Ryr1 UTSW 7 29085870 missense probably benign 0.00
R7493:Ryr1 UTSW 7 29095205 missense probably benign 0.44
R7570:Ryr1 UTSW 7 29078585 missense probably damaging 0.98
R7593:Ryr1 UTSW 7 29036103 missense probably damaging 1.00
R7769:Ryr1 UTSW 7 29098785 missense probably damaging 1.00
R7781:Ryr1 UTSW 7 29067630 missense probably damaging 1.00
R7790:Ryr1 UTSW 7 29104832 missense probably benign 0.39
R7799:Ryr1 UTSW 7 29003560 splice site probably null
R7916:Ryr1 UTSW 7 29090939 nonsense probably null
R7922:Ryr1 UTSW 7 29097224 missense probably benign 0.09
R7988:Ryr1 UTSW 7 29096171 missense probably benign 0.29
R7997:Ryr1 UTSW 7 29003543 missense unknown
R8052:Ryr1 UTSW 7 29083385 missense probably benign 0.05
R8096:Ryr1 UTSW 7 29009201 missense unknown
R8116:Ryr1 UTSW 7 29110883 missense probably benign 0.03
R8202:Ryr1 UTSW 7 29091032 missense probably benign 0.18
R8207:Ryr1 UTSW 7 29090225 missense probably damaging 1.00
R8257:Ryr1 UTSW 7 29064639 missense possibly damaging 0.82
R8354:Ryr1 UTSW 7 29015717 missense unknown
R8454:Ryr1 UTSW 7 29015717 missense unknown
X0021:Ryr1 UTSW 7 29061531 missense probably damaging 1.00
Z1176:Ryr1 UTSW 7 29020214 missense probably damaging 1.00
Z1176:Ryr1 UTSW 7 29086035 missense probably benign 0.10
Z1176:Ryr1 UTSW 7 29103498 missense probably damaging 1.00
Z1177:Ryr1 UTSW 7 29017985 missense unknown
Z1177:Ryr1 UTSW 7 29048792 nonsense probably null
Z1177:Ryr1 UTSW 7 29101922 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCAGTCCTCATTGCAACCC -3'
(R):5'- AGGTTAGAGTCCTGGATTCCAATC -3'

Sequencing Primer
(F):5'- ACAGTCCCTCGATCACCTGG -3'
(R):5'- GATTCCAATCCTGACTGACCC -3'
Posted On2020-07-28