Incidental Mutation 'R8248:Adam32'
ID640374
Institutional Source Beutler Lab
Gene Symbol Adam32
Ensembl Gene ENSMUSG00000037437
Gene Namea disintegrin and metallopeptidase domain 32
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8248 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location24836140-24948804 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24901470 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 343 (S343P)
Ref Sequence ENSEMBL: ENSMUSP00000113627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119720] [ENSMUST00000121438]
Predicted Effect probably benign
Transcript: ENSMUST00000119720
AA Change: S343P

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000113076
Gene: ENSMUSG00000037437
AA Change: S343P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 32 145 4.5e-32 PFAM
Pfam:Reprolysin 187 384 4.1e-66 PFAM
Pfam:Reprolysin_3 211 318 6.2e-7 PFAM
DISIN 400 481 2.69e-16 SMART
ACR 482 622 6.83e-38 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000121438
AA Change: S343P

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113627
Gene: ENSMUSG00000037437
AA Change: S343P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 24 145 8.4e-26 PFAM
Pfam:Reprolysin 187 384 1.3e-68 PFAM
DISIN 400 481 2.69e-16 SMART
ACR 482 622 6.83e-38 SMART
EGF 631 660 1.73e0 SMART
transmembrane domain 689 711 N/A INTRINSIC
low complexity region 719 754 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: This gene encodes a member of the disintegrin family of membrane-anchored proteins that play a role in diverse biological processes such as brain development, fertilization, tumor development and inflammation. The encoded protein undergoes proteolytic processing to generate a mature polypeptide comprised of an metalloprotease, disintegrin and epidermal growth factor-like domains. This gene was found to be expressed predominantly in the pachytene spermatocytes, where the processed protein is localized to the sperm surface. This gene is located in a cluster of other disintegrin and metallopeptidase family genes on chromosome 8. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate mature protein. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930003A15Rik T C 16: 19,883,806 D24G noncoding transcript Het
Agbl2 G A 2: 90,797,564 G238R probably damaging Het
Ahi1 T A 10: 20,972,092 D466E probably benign Het
Ahnak T A 19: 9,001,946 V198E probably damaging Het
Ank2 T A 3: 126,937,785 H658L possibly damaging Het
Atp8b5 T A 4: 43,366,072 I781N probably damaging Het
Bloc1s6 A T 2: 122,742,645 R47* probably null Het
Clk2 G A 3: 89,173,504 V266M probably damaging Het
Cul9 A C 17: 46,530,014 Y777D probably damaging Het
Dcp1a C T 14: 30,479,598 probably benign Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Dnajb2 T G 1: 75,243,582 D248E Het
Dpy19l1 T C 9: 24,502,895 H79R probably benign Het
Elmo1 T C 13: 20,600,201 S643P probably damaging Het
Evi5 A G 5: 107,818,887 probably null Het
Fam76b T C 9: 13,831,102 C110R probably damaging Het
Galnt7 T A 8: 57,538,188 K429N probably benign Het
Gm10142 T A 10: 77,716,116 C104S probably damaging Het
Gm7298 A C 6: 121,787,443 H1427P probably benign Het
Golga7b A T 19: 42,266,871 I87F probably damaging Het
Gpr165 C A X: 96,714,017 D7E probably benign Het
Gpr25 C A 1: 136,260,677 R66L probably benign Het
H2-Q2 A G 17: 35,344,865 N241D probably benign Het
Il1a T C 2: 129,302,961 D179G probably benign Het
Itch T C 2: 155,206,383 probably null Het
Itsn2 T C 12: 4,662,052 V913A probably benign Het
Kdm1b T A 13: 47,071,878 probably benign Het
Lama4 T C 10: 39,061,379 I655T possibly damaging Het
Lats1 T A 10: 7,705,903 S817R probably damaging Het
Lrrc8c A T 5: 105,607,867 M503L probably benign Het
Mast4 T C 13: 102,738,721 T1380A probably damaging Het
Mfap1a G T 2: 121,506,495 T16K possibly damaging Het
Mroh2b C T 15: 4,931,104 T773I probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nudt7 A G 8: 114,151,997 Y255C probably benign Het
Pfas T C 11: 69,000,263 T310A probably damaging Het
Pkhd1l1 T G 15: 44,543,546 I2393R probably damaging Het
Pmm1 A C 15: 81,960,731 L24R possibly damaging Het
Pram1 T C 17: 33,641,164 V235A probably benign Het
Prg4 T C 1: 150,455,126 T599A unknown Het
Prpf40b A G 15: 99,316,285 K812E unknown Het
Qars G A 9: 108,509,452 A155T probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rgs6 A G 12: 83,137,704 probably benign Het
Rom1 T A 19: 8,928,681 R165W probably damaging Het
Rps6kb2 T A 19: 4,156,988 probably benign Het
Ryr1 A T 7: 29,069,121 W2808R probably damaging Het
Sh3gl1 A G 17: 56,019,038 probably null Het
Slc22a30 A T 19: 8,370,199 M279K probably benign Het
Snx11 A G 11: 96,769,933 S184P unknown Het
Srgap1 A G 10: 121,804,817 C692R probably damaging Het
Srgap3 T C 6: 112,723,143 N982S probably damaging Het
Stac T A 9: 111,593,745 D270V probably benign Het
Syn3 T A 10: 86,135,021 I246F probably benign Het
Tnr T C 1: 159,892,093 V980A probably damaging Het
Usp17le G T 7: 104,769,794 A47E possibly damaging Het
Vmn2r118 T C 17: 55,610,936 N192S probably benign Het
Zmym4 C A 4: 126,905,369 V725L possibly damaging Het
Other mutations in Adam32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00775:Adam32 APN 8 24921354 missense probably damaging 1.00
IGL00793:Adam32 APN 8 24837830 splice site probably benign
IGL01317:Adam32 APN 8 24872581 missense probably damaging 1.00
IGL01475:Adam32 APN 8 24872648 missense probably damaging 1.00
IGL01501:Adam32 APN 8 24914353 missense probably damaging 1.00
IGL01659:Adam32 APN 8 24870774 splice site probably benign
IGL01994:Adam32 APN 8 24902796 splice site probably benign
IGL02137:Adam32 APN 8 24872594 missense probably damaging 1.00
IGL02393:Adam32 APN 8 24920053 missense probably damaging 1.00
IGL02516:Adam32 APN 8 24898596 missense probably damaging 1.00
IGL02892:Adam32 APN 8 24878711 intron probably benign
IGL02929:Adam32 APN 8 24872643 missense possibly damaging 0.81
IGL03273:Adam32 APN 8 24921340 missense probably damaging 1.00
PIT4515001:Adam32 UTSW 8 24914326 missense possibly damaging 0.88
R0088:Adam32 UTSW 8 24914067 missense probably damaging 1.00
R0098:Adam32 UTSW 8 24914389 missense possibly damaging 0.79
R0098:Adam32 UTSW 8 24914389 missense possibly damaging 0.79
R0189:Adam32 UTSW 8 24922337 critical splice acceptor site probably null
R1740:Adam32 UTSW 8 24921298 missense probably damaging 1.00
R1853:Adam32 UTSW 8 24898626 missense probably benign 0.02
R2090:Adam32 UTSW 8 24901440 critical splice donor site probably null
R2906:Adam32 UTSW 8 24863504 missense probably damaging 1.00
R2907:Adam32 UTSW 8 24863504 missense probably damaging 1.00
R4304:Adam32 UTSW 8 24901529 missense probably damaging 1.00
R4612:Adam32 UTSW 8 24872736 missense probably damaging 1.00
R4673:Adam32 UTSW 8 24884455 missense probably damaging 1.00
R4786:Adam32 UTSW 8 24863493 missense probably damaging 1.00
R5292:Adam32 UTSW 8 24864451 missense possibly damaging 0.85
R5398:Adam32 UTSW 8 24872579 missense possibly damaging 0.95
R5524:Adam32 UTSW 8 24922312 missense probably damaging 0.99
R5939:Adam32 UTSW 8 24914122 missense probably damaging 1.00
R6350:Adam32 UTSW 8 24863429 missense possibly damaging 0.86
R6766:Adam32 UTSW 8 24872630 missense probably damaging 0.96
R6893:Adam32 UTSW 8 24878754 missense probably damaging 1.00
R7095:Adam32 UTSW 8 24914070 missense probably damaging 1.00
R7241:Adam32 UTSW 8 24898494 missense probably benign 0.00
R7457:Adam32 UTSW 8 24884619 missense probably damaging 0.98
R7864:Adam32 UTSW 8 24922276 missense probably benign 0.11
R8083:Adam32 UTSW 8 24872736 missense probably damaging 1.00
R8376:Adam32 UTSW 8 24919920 missense possibly damaging 0.81
Z1176:Adam32 UTSW 8 24948750 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGTAACAGTCTGCAGGTAAATGAC -3'
(R):5'- TCACCGATTATGAAGTGTTTGGTAC -3'

Sequencing Primer
(F):5'- GGTAAATGACCCCACGGAC -3'
(R):5'- TGGTAGTACCCCAAGGAT -3'
Posted On2020-07-28