Incidental Mutation 'R8248:Nudt7'
ID640376
Institutional Source Beutler Lab
Gene Symbol Nudt7
Ensembl Gene ENSMUSG00000031767
Gene Namenudix (nucleoside diphosphate linked moiety X)-type motif 7
Synonyms2210404C19Rik, 1300007B24Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R8248 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location114133557-114154739 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 114151997 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 255 (Y255C)
Ref Sequence ENSEMBL: ENSMUSP00000104737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066514] [ENSMUST00000073521] [ENSMUST00000109109] [ENSMUST00000134593] [ENSMUST00000147605]
Predicted Effect probably benign
Transcript: ENSMUST00000066514
AA Change: Y202C

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000065791
Gene: ENSMUSG00000031767
AA Change: Y202C

DomainStartEndE-ValueType
Pfam:NUDIX 15 140 4.1e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073521
AA Change: Y231C

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000073213
Gene: ENSMUSG00000031767
AA Change: Y231C

DomainStartEndE-ValueType
Pfam:NUDIX 38 168 4.4e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109109
AA Change: Y255C

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000104737
Gene: ENSMUSG00000031767
AA Change: Y255C

DomainStartEndE-ValueType
Pfam:NUDIX 62 193 3.2e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134593
SMART Domains Protein: ENSMUSP00000116868
Gene: ENSMUSG00000031767

DomainStartEndE-ValueType
Pfam:NUDIX 38 146 4.2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147605
AA Change: Y211C

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000114598
Gene: ENSMUSG00000031767
AA Change: Y211C

DomainStartEndE-ValueType
Pfam:NUDIX 38 107 1.2e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Nudix hydrolase family. Nudix hydrolases eliminate potentially toxic nucleotide metabolites from the cell and regulate the concentrations and availability of many different nucleotide substrates, cofactors, and signaling molecules. Alternatively spliced transcript variants encoding multiple isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930003A15Rik T C 16: 19,883,806 D24G noncoding transcript Het
Adam32 A G 8: 24,901,470 S343P possibly damaging Het
Agbl2 G A 2: 90,797,564 G238R probably damaging Het
Ahi1 T A 10: 20,972,092 D466E probably benign Het
Ahnak T A 19: 9,001,946 V198E probably damaging Het
Ank2 T A 3: 126,937,785 H658L possibly damaging Het
Atp8b5 T A 4: 43,366,072 I781N probably damaging Het
Bloc1s6 A T 2: 122,742,645 R47* probably null Het
Clk2 G A 3: 89,173,504 V266M probably damaging Het
Cul9 A C 17: 46,530,014 Y777D probably damaging Het
Dcp1a C T 14: 30,479,598 probably benign Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Dnajb2 T G 1: 75,243,582 D248E Het
Dpy19l1 T C 9: 24,502,895 H79R probably benign Het
Elmo1 T C 13: 20,600,201 S643P probably damaging Het
Evi5 A G 5: 107,818,887 probably null Het
Fam76b T C 9: 13,831,102 C110R probably damaging Het
Galnt7 T A 8: 57,538,188 K429N probably benign Het
Gm10142 T A 10: 77,716,116 C104S probably damaging Het
Gm7298 A C 6: 121,787,443 H1427P probably benign Het
Golga7b A T 19: 42,266,871 I87F probably damaging Het
Gpr165 C A X: 96,714,017 D7E probably benign Het
Gpr25 C A 1: 136,260,677 R66L probably benign Het
H2-Q2 A G 17: 35,344,865 N241D probably benign Het
Il1a T C 2: 129,302,961 D179G probably benign Het
Itch T C 2: 155,206,383 probably null Het
Itsn2 T C 12: 4,662,052 V913A probably benign Het
Kdm1b T A 13: 47,071,878 probably benign Het
Lama4 T C 10: 39,061,379 I655T possibly damaging Het
Lats1 T A 10: 7,705,903 S817R probably damaging Het
Lrrc8c A T 5: 105,607,867 M503L probably benign Het
Mast4 T C 13: 102,738,721 T1380A probably damaging Het
Mfap1a G T 2: 121,506,495 T16K possibly damaging Het
Mroh2b C T 15: 4,931,104 T773I probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Pfas T C 11: 69,000,263 T310A probably damaging Het
Pkhd1l1 T G 15: 44,543,546 I2393R probably damaging Het
Pmm1 A C 15: 81,960,731 L24R possibly damaging Het
Pram1 T C 17: 33,641,164 V235A probably benign Het
Prg4 T C 1: 150,455,126 T599A unknown Het
Prpf40b A G 15: 99,316,285 K812E unknown Het
Qars G A 9: 108,509,452 A155T probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rgs6 A G 12: 83,137,704 probably benign Het
Rom1 T A 19: 8,928,681 R165W probably damaging Het
Rps6kb2 T A 19: 4,156,988 probably benign Het
Ryr1 A T 7: 29,069,121 W2808R probably damaging Het
Sh3gl1 A G 17: 56,019,038 probably null Het
Slc22a30 A T 19: 8,370,199 M279K probably benign Het
Snx11 A G 11: 96,769,933 S184P unknown Het
Srgap1 A G 10: 121,804,817 C692R probably damaging Het
Srgap3 T C 6: 112,723,143 N982S probably damaging Het
Stac T A 9: 111,593,745 D270V probably benign Het
Syn3 T A 10: 86,135,021 I246F probably benign Het
Tnr T C 1: 159,892,093 V980A probably damaging Het
Usp17le G T 7: 104,769,794 A47E possibly damaging Het
Vmn2r118 T C 17: 55,610,936 N192S probably benign Het
Zmym4 C A 4: 126,905,369 V725L possibly damaging Het
Other mutations in Nudt7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01554:Nudt7 APN 8 114147885 splice site probably benign
IGL02549:Nudt7 APN 8 114151948 missense probably damaging 1.00
R0525:Nudt7 UTSW 8 114151652 critical splice acceptor site probably null
R0781:Nudt7 UTSW 8 114135371 intron probably benign
R5167:Nudt7 UTSW 8 114151827 nonsense probably null
R5198:Nudt7 UTSW 8 114135445 splice site probably null
R5562:Nudt7 UTSW 8 114147983 missense probably damaging 1.00
R5597:Nudt7 UTSW 8 114151766 missense probably benign 0.12
R6957:Nudt7 UTSW 8 114133645 missense probably benign 0.03
R7410:Nudt7 UTSW 8 114133819 intron probably benign
R8245:Nudt7 UTSW 8 114136340 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCTTCGAGTACAAAGACCC -3'
(R):5'- GGTAAAATTATTCTCCCCTGCCAG -3'

Sequencing Primer
(F):5'- ACCCTGAGACTGGTGTGAACTAC -3'
(R):5'- CCAGTGCATTTTTCCAGTTTTGAAAG -3'
Posted On2020-07-28