Incidental Mutation 'R8248:Qars'
ID640379
Institutional Source Beutler Lab
Gene Symbol Qars
Ensembl Gene ENSMUSG00000032604
Gene Nameglutaminyl-tRNA synthetase
Synonyms1110018N24Rik, 1200016L19Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R8248 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location108507706-108515941 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 108509452 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 155 (A155T)
Ref Sequence ENSEMBL: ENSMUSP00000006838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006838] [ENSMUST00000134939] [ENSMUST00000194045] [ENSMUST00000207790] [ENSMUST00000207810] [ENSMUST00000207862] [ENSMUST00000207947] [ENSMUST00000208162] [ENSMUST00000208177] [ENSMUST00000208214] [ENSMUST00000208581]
Predicted Effect probably benign
Transcript: ENSMUST00000006838
AA Change: A155T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000006838
Gene: ENSMUSG00000032604
AA Change: A155T

DomainStartEndE-ValueType
Pfam:tRNA_synt_1c_R1 4 162 1.2e-54 PFAM
Pfam:tRNA_synt_1c_R2 165 256 6.5e-31 PFAM
Pfam:tRNA-synt_1c 263 563 4.5e-119 PFAM
Pfam:tRNA-synt_1c_C 565 752 6.9e-48 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000122918
Gene: ENSMUSG00000032604
AA Change: A155T

DomainStartEndE-ValueType
Pfam:tRNA_synt_1c_R1 1 163 1.1e-55 PFAM
Pfam:tRNA_synt_1c_R2 164 256 6.9e-31 PFAM
Pfam:tRNA-synt_1c 263 563 2.5e-115 PFAM
Pfam:tRNA-synt_1c_C 565 720 5.7e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141903
SMART Domains Protein: ENSMUSP00000121146
Gene: ENSMUSG00000032604

DomainStartEndE-ValueType
Pfam:tRNA-synt_1c 2 148 2.1e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194045
Predicted Effect probably benign
Transcript: ENSMUST00000207180
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000207734
Predicted Effect probably benign
Transcript: ENSMUST00000207790
Predicted Effect probably benign
Transcript: ENSMUST00000207810
AA Change: A155T

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000207862
AA Change: A143T

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000207947
AA Change: A155T

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000208074
Predicted Effect probably benign
Transcript: ENSMUST00000208162
Predicted Effect probably benign
Transcript: ENSMUST00000208177
Predicted Effect probably benign
Transcript: ENSMUST00000208214
Predicted Effect probably benign
Transcript: ENSMUST00000208506
Predicted Effect probably benign
Transcript: ENSMUST00000208581
AA Change: A155T

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930003A15Rik T C 16: 19,883,806 D24G noncoding transcript Het
Adam32 A G 8: 24,901,470 S343P possibly damaging Het
Agbl2 G A 2: 90,797,564 G238R probably damaging Het
Ahi1 T A 10: 20,972,092 D466E probably benign Het
Ahnak T A 19: 9,001,946 V198E probably damaging Het
Ank2 T A 3: 126,937,785 H658L possibly damaging Het
Atp8b5 T A 4: 43,366,072 I781N probably damaging Het
Bloc1s6 A T 2: 122,742,645 R47* probably null Het
Clk2 G A 3: 89,173,504 V266M probably damaging Het
Cul9 A C 17: 46,530,014 Y777D probably damaging Het
Dcp1a C T 14: 30,479,598 probably benign Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Dnajb2 T G 1: 75,243,582 D248E Het
Dpy19l1 T C 9: 24,502,895 H79R probably benign Het
Elmo1 T C 13: 20,600,201 S643P probably damaging Het
Evi5 A G 5: 107,818,887 probably null Het
Fam76b T C 9: 13,831,102 C110R probably damaging Het
Galnt7 T A 8: 57,538,188 K429N probably benign Het
Gm10142 T A 10: 77,716,116 C104S probably damaging Het
Gm7298 A C 6: 121,787,443 H1427P probably benign Het
Golga7b A T 19: 42,266,871 I87F probably damaging Het
Gpr165 C A X: 96,714,017 D7E probably benign Het
Gpr25 C A 1: 136,260,677 R66L probably benign Het
H2-Q2 A G 17: 35,344,865 N241D probably benign Het
Il1a T C 2: 129,302,961 D179G probably benign Het
Itch T C 2: 155,206,383 probably null Het
Itsn2 T C 12: 4,662,052 V913A probably benign Het
Kdm1b T A 13: 47,071,878 probably benign Het
Lama4 T C 10: 39,061,379 I655T possibly damaging Het
Lats1 T A 10: 7,705,903 S817R probably damaging Het
Lrrc8c A T 5: 105,607,867 M503L probably benign Het
Mast4 T C 13: 102,738,721 T1380A probably damaging Het
Mfap1a G T 2: 121,506,495 T16K possibly damaging Het
Mroh2b C T 15: 4,931,104 T773I probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nudt7 A G 8: 114,151,997 Y255C probably benign Het
Pfas T C 11: 69,000,263 T310A probably damaging Het
Pkhd1l1 T G 15: 44,543,546 I2393R probably damaging Het
Pmm1 A C 15: 81,960,731 L24R possibly damaging Het
Pram1 T C 17: 33,641,164 V235A probably benign Het
Prg4 T C 1: 150,455,126 T599A unknown Het
Prpf40b A G 15: 99,316,285 K812E unknown Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rgs6 A G 12: 83,137,704 probably benign Het
Rom1 T A 19: 8,928,681 R165W probably damaging Het
Rps6kb2 T A 19: 4,156,988 probably benign Het
Ryr1 A T 7: 29,069,121 W2808R probably damaging Het
Sh3gl1 A G 17: 56,019,038 probably null Het
Slc22a30 A T 19: 8,370,199 M279K probably benign Het
Snx11 A G 11: 96,769,933 S184P unknown Het
Srgap1 A G 10: 121,804,817 C692R probably damaging Het
Srgap3 T C 6: 112,723,143 N982S probably damaging Het
Stac T A 9: 111,593,745 D270V probably benign Het
Syn3 T A 10: 86,135,021 I246F probably benign Het
Tnr T C 1: 159,892,093 V980A probably damaging Het
Usp17le G T 7: 104,769,794 A47E possibly damaging Het
Vmn2r118 T C 17: 55,610,936 N192S probably benign Het
Zmym4 C A 4: 126,905,369 V725L possibly damaging Het
Other mutations in Qars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01570:Qars APN 9 108511539 missense probably damaging 1.00
IGL02336:Qars APN 9 108514986 nonsense probably null
IGL02393:Qars APN 9 108514329 missense probably benign 0.00
IGL03102:Qars APN 9 108508919 missense probably benign 0.35
R0576:Qars UTSW 9 108514962 intron probably benign
R1777:Qars UTSW 9 108508201 critical splice donor site probably null
R1824:Qars UTSW 9 108514610 missense probably damaging 1.00
R1871:Qars UTSW 9 108514116 splice site probably null
R1897:Qars UTSW 9 108514083 nonsense probably null
R1952:Qars UTSW 9 108513181 missense probably benign 0.35
R1981:Qars UTSW 9 108515028 missense probably damaging 1.00
R2172:Qars UTSW 9 108509200 missense probably damaging 1.00
R2698:Qars UTSW 9 108508443 missense possibly damaging 0.65
R4381:Qars UTSW 9 108510183 unclassified probably benign
R4608:Qars UTSW 9 108509426 splice site probably null
R4677:Qars UTSW 9 108509690 unclassified probably benign
R4974:Qars UTSW 9 108508931 missense probably damaging 1.00
R5234:Qars UTSW 9 108514165 missense probably damaging 1.00
R5548:Qars UTSW 9 108512918 missense possibly damaging 0.72
R5817:Qars UTSW 9 108510242 unclassified probably benign
R6029:Qars UTSW 9 108513690 missense probably damaging 1.00
R6110:Qars UTSW 9 108508098 missense probably benign 0.02
R6889:Qars UTSW 9 108513183 missense probably damaging 0.98
R7034:Qars UTSW 9 108514777 missense probably damaging 1.00
R7036:Qars UTSW 9 108514777 missense probably damaging 1.00
R7136:Qars UTSW 9 108512772 missense probably damaging 1.00
R7178:Qars UTSW 9 108515123 missense possibly damaging 0.50
R7192:Qars UTSW 9 108511561 missense probably damaging 1.00
R7235:Qars UTSW 9 108510132 missense probably damaging 1.00
R7813:Qars UTSW 9 108509471 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACATGGGGCTGCTAATGGG -3'
(R):5'- TCAGAGACCCAAGTTAAGCGC -3'

Sequencing Primer
(F):5'- CAGGGAGTTACTTGGAAGTGCATC -3'
(R):5'- AAGTTAAGCGCTACTCCCTC -3'
Posted On2020-07-28