Incidental Mutation 'R8248:Stac'
ID640380
Institutional Source Beutler Lab
Gene Symbol Stac
Ensembl Gene ENSMUSG00000032502
Gene Namesrc homology three (SH3) and cysteine rich domain
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R8248 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location111561437-111690348 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 111593745 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 270 (D270V)
Ref Sequence ENSEMBL: ENSMUSP00000035083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035083] [ENSMUST00000161995]
Predicted Effect probably benign
Transcript: ENSMUST00000035083
AA Change: D270V

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000035083
Gene: ENSMUSG00000032502
AA Change: D270V

DomainStartEndE-ValueType
low complexity region 78 93 N/A INTRINSIC
C1 109 160 5.91e-13 SMART
low complexity region 213 232 N/A INTRINSIC
SH3 289 344 3.45e-20 SMART
Pfam:SH3_2 349 401 6.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161995
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930003A15Rik T C 16: 19,883,806 D24G noncoding transcript Het
Adam32 A G 8: 24,901,470 S343P possibly damaging Het
Agbl2 G A 2: 90,797,564 G238R probably damaging Het
Ahi1 T A 10: 20,972,092 D466E probably benign Het
Ahnak T A 19: 9,001,946 V198E probably damaging Het
Ank2 T A 3: 126,937,785 H658L possibly damaging Het
Atp2b4 TTCTTC TTCTTCGTCTTC 1: 133,701,718 probably benign Het
Atp2b4 TCTTCT TCTTCTCCTTCT 1: 133,701,743 probably benign Het
Atp8b5 T A 4: 43,366,072 I781N probably damaging Het
Bloc1s6 A T 2: 122,742,645 R47* probably null Het
Clk2 G A 3: 89,173,504 V266M probably damaging Het
Cul9 A C 17: 46,530,014 Y777D probably damaging Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Dcp1a C T 14: 30,479,598 probably benign Het
Dnajb2 T G 1: 75,243,582 D248E Het
Dpy19l1 T C 9: 24,502,895 H79R probably benign Het
Elmo1 T C 13: 20,600,201 S643P probably damaging Het
Evi5 A G 5: 107,818,887 probably null Het
Fam76b T C 9: 13,831,102 C110R probably damaging Het
Galnt7 T A 8: 57,538,188 K429N probably benign Het
Gm10142 T A 10: 77,716,116 C104S probably damaging Het
Gm7298 A C 6: 121,787,443 H1427P probably benign Het
Golga7b A T 19: 42,266,871 I87F probably damaging Het
Gpr165 C A X: 96,714,017 D7E probably benign Het
Gpr25 C A 1: 136,260,677 R66L probably benign Het
H2-Q2 A G 17: 35,344,865 N241D probably benign Het
Il1a T C 2: 129,302,961 D179G probably benign Het
Itch T C 2: 155,206,383 probably null Het
Itsn2 T C 12: 4,662,052 V913A probably benign Het
Lama4 T C 10: 39,061,379 I655T possibly damaging Het
Lats1 T A 10: 7,705,903 S817R probably damaging Het
Lrrc8c A T 5: 105,607,867 M503L probably benign Het
Mast4 T C 13: 102,738,721 T1380A probably damaging Het
Mfap1a G T 2: 121,506,495 T16K possibly damaging Het
Mroh2b C T 15: 4,931,104 T773I probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nudt7 A G 8: 114,151,997 Y255C probably benign Het
Pfas T C 11: 69,000,263 T310A probably damaging Het
Pkhd1l1 T G 15: 44,543,546 I2393R probably damaging Het
Pmm1 A C 15: 81,960,731 L24R possibly damaging Het
Pram1 T C 17: 33,641,164 V235A probably benign Het
Prg4 T C 1: 150,455,126 T599A unknown Het
Prpf40b A G 15: 99,316,285 K812E unknown Het
Qars G A 9: 108,509,452 A155T probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rom1 T A 19: 8,928,681 R165W probably damaging Het
Ryr1 A T 7: 29,069,121 W2808R probably damaging Het
Sh3gl1 A G 17: 56,019,038 probably null Het
Slc22a30 A T 19: 8,370,199 M279K probably benign Het
Snx11 A G 11: 96,769,933 S184P unknown Het
Srgap1 A G 10: 121,804,817 C692R probably damaging Het
Srgap3 T C 6: 112,723,143 N982S probably damaging Het
Syn3 T A 10: 86,135,021 I246F probably benign Het
Tnr T C 1: 159,892,093 V980A probably damaging Het
Usp17le G T 7: 104,769,794 A47E possibly damaging Het
Vmn2r118 T C 17: 55,610,936 N192S probably benign Het
Zmym4 C A 4: 126,905,369 V725L possibly damaging Het
Other mutations in Stac
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Stac APN 9 111635039 missense probably damaging 1.00
IGL01870:Stac APN 9 111572332 missense probably benign 0.22
IGL02999:Stac APN 9 111604130 missense probably damaging 1.00
IGL03004:Stac APN 9 111602540 missense probably benign 0.00
R0240:Stac UTSW 9 111635021 missense probably damaging 0.99
R0240:Stac UTSW 9 111635021 missense probably damaging 0.99
R1777:Stac UTSW 9 111604082 missense possibly damaging 0.94
R2210:Stac UTSW 9 111602570 missense probably damaging 0.99
R2237:Stac UTSW 9 111690122 start gained probably benign
R2238:Stac UTSW 9 111690122 start gained probably benign
R2239:Stac UTSW 9 111690122 start gained probably benign
R4125:Stac UTSW 9 111604058 critical splice donor site probably null
R4126:Stac UTSW 9 111604058 critical splice donor site probably null
R4128:Stac UTSW 9 111604058 critical splice donor site probably null
R7069:Stac UTSW 9 111572326 missense possibly damaging 0.89
X0057:Stac UTSW 9 111572333 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TCACATTATGCGTCACTGCAC -3'
(R):5'- CAGGATGCTGCATGAGGATG -3'

Sequencing Primer
(F):5'- ACTGCACTTATCATCAGGCATG -3'
(R):5'- CTGCATGAGGATGAGGGACCTG -3'
Posted On2020-07-28