Incidental Mutation 'R8248:Ahi1'
ID640382
Institutional Source Beutler Lab
Gene Symbol Ahi1
Ensembl Gene ENSMUSG00000019986
Gene NameAbelson helper integration site 1
Synonyms1700015F03Rik, Jouberin, D10Bwg0629e, Ahi-1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.848) question?
Stock #R8248 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location20952547-21080429 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 20972092 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 466 (D466E)
Ref Sequence ENSEMBL: ENSMUSP00000101164 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105525]
Predicted Effect probably benign
Transcript: ENSMUST00000105525
AA Change: D466E

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000101164
Gene: ENSMUSG00000019986
AA Change: D466E

DomainStartEndE-ValueType
low complexity region 50 67 N/A INTRINSIC
low complexity region 85 106 N/A INTRINSIC
low complexity region 148 159 N/A INTRINSIC
WD40 448 490 4.3e-1 SMART
WD40 493 532 9.3e-9 SMART
WD40 537 576 2.48e-4 SMART
WD40 583 622 6.09e-4 SMART
WD40 641 678 1.9e2 SMART
WD40 684 721 3.98e0 SMART
WD40 724 769 9.51e1 SMART
SH3 905 961 2.15e-21 SMART
low complexity region 975 989 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is apparently required for both cerebellar and cortical development in humans. This gene mutations cause specific forms of Joubert syndrome-related disorders. Joubert syndrome (JS) is a recessively inherited developmental brain disorder with several identified causative chromosomal loci. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mouse embryonic fibroblasts homozygous for one knock-out allele exhibit reduced and abnormal cilia. Mice homozygous for another knock-out allele exhibit premature death and abnormal kidney morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930003A15Rik T C 16: 19,883,806 D24G noncoding transcript Het
Adam32 A G 8: 24,901,470 S343P possibly damaging Het
Agbl2 G A 2: 90,797,564 G238R probably damaging Het
Ahnak T A 19: 9,001,946 V198E probably damaging Het
Ank2 T A 3: 126,937,785 H658L possibly damaging Het
Atp8b5 T A 4: 43,366,072 I781N probably damaging Het
Bloc1s6 A T 2: 122,742,645 R47* probably null Het
Clk2 G A 3: 89,173,504 V266M probably damaging Het
Cul9 A C 17: 46,530,014 Y777D probably damaging Het
Dcp1a C T 14: 30,479,598 probably benign Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Dnajb2 T G 1: 75,243,582 D248E Het
Dpy19l1 T C 9: 24,502,895 H79R probably benign Het
Elmo1 T C 13: 20,600,201 S643P probably damaging Het
Evi5 A G 5: 107,818,887 probably null Het
Fam76b T C 9: 13,831,102 C110R probably damaging Het
Galnt7 T A 8: 57,538,188 K429N probably benign Het
Gm10142 T A 10: 77,716,116 C104S probably damaging Het
Gm7298 A C 6: 121,787,443 H1427P probably benign Het
Golga7b A T 19: 42,266,871 I87F probably damaging Het
Gpr165 C A X: 96,714,017 D7E probably benign Het
Gpr25 C A 1: 136,260,677 R66L probably benign Het
H2-Q2 A G 17: 35,344,865 N241D probably benign Het
Il1a T C 2: 129,302,961 D179G probably benign Het
Itch T C 2: 155,206,383 probably null Het
Itsn2 T C 12: 4,662,052 V913A probably benign Het
Kdm1b T A 13: 47,071,878 probably benign Het
Lama4 T C 10: 39,061,379 I655T possibly damaging Het
Lats1 T A 10: 7,705,903 S817R probably damaging Het
Lrrc8c A T 5: 105,607,867 M503L probably benign Het
Mast4 T C 13: 102,738,721 T1380A probably damaging Het
Mfap1a G T 2: 121,506,495 T16K possibly damaging Het
Mroh2b C T 15: 4,931,104 T773I probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nudt7 A G 8: 114,151,997 Y255C probably benign Het
Pfas T C 11: 69,000,263 T310A probably damaging Het
Pkhd1l1 T G 15: 44,543,546 I2393R probably damaging Het
Pmm1 A C 15: 81,960,731 L24R possibly damaging Het
Pram1 T C 17: 33,641,164 V235A probably benign Het
Prg4 T C 1: 150,455,126 T599A unknown Het
Prpf40b A G 15: 99,316,285 K812E unknown Het
Qars G A 9: 108,509,452 A155T probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rgs6 A G 12: 83,137,704 probably benign Het
Rom1 T A 19: 8,928,681 R165W probably damaging Het
Rps6kb2 T A 19: 4,156,988 probably benign Het
Ryr1 A T 7: 29,069,121 W2808R probably damaging Het
Sh3gl1 A G 17: 56,019,038 probably null Het
Slc22a30 A T 19: 8,370,199 M279K probably benign Het
Snx11 A G 11: 96,769,933 S184P unknown Het
Srgap1 A G 10: 121,804,817 C692R probably damaging Het
Srgap3 T C 6: 112,723,143 N982S probably damaging Het
Stac T A 9: 111,593,745 D270V probably benign Het
Syn3 T A 10: 86,135,021 I246F probably benign Het
Tnr T C 1: 159,892,093 V980A probably damaging Het
Usp17le G T 7: 104,769,794 A47E possibly damaging Het
Vmn2r118 T C 17: 55,610,936 N192S probably benign Het
Zmym4 C A 4: 126,905,369 V725L possibly damaging Het
Other mutations in Ahi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Ahi1 APN 10 20972141 missense probably damaging 1.00
IGL00914:Ahi1 APN 10 20984299 splice site probably null
IGL01075:Ahi1 APN 10 20987025 missense possibly damaging 0.80
IGL01094:Ahi1 APN 10 20972060 missense probably damaging 0.99
IGL01128:Ahi1 APN 10 21074433 missense probably benign
IGL01527:Ahi1 APN 10 20960085 splice site probably benign
IGL01821:Ahi1 APN 10 21041243 critical splice donor site probably null
IGL02159:Ahi1 APN 10 21058177 missense probably benign 0.13
IGL02176:Ahi1 APN 10 20970916 missense probably benign 0.00
IGL02200:Ahi1 APN 10 20981314 splice site probably benign
IGL02232:Ahi1 APN 10 20981375 missense probably damaging 1.00
IGL02305:Ahi1 APN 10 20970897 missense probably benign 0.00
IGL02323:Ahi1 APN 10 20972034 missense probably damaging 1.00
IGL02885:Ahi1 APN 10 21055113 missense possibly damaging 0.61
IGL02958:Ahi1 APN 10 20963799 missense probably damaging 1.00
IGL02971:Ahi1 APN 10 21000551 missense possibly damaging 0.93
IGL03109:Ahi1 APN 10 20970942 missense probably benign 0.00
IGL03192:Ahi1 APN 10 20965635 missense probably benign 0.00
IGL03377:Ahi1 APN 10 21018004 missense possibly damaging 0.51
P4717OSA:Ahi1 UTSW 10 20972110 missense probably damaging 1.00
P4748:Ahi1 UTSW 10 20972110 missense probably damaging 1.00
R0448:Ahi1 UTSW 10 20972075 missense probably damaging 1.00
R0559:Ahi1 UTSW 10 21000719 splice site probably benign
R0627:Ahi1 UTSW 10 20965522 missense probably benign 0.10
R0652:Ahi1 UTSW 10 20979461 missense probably damaging 1.00
R0690:Ahi1 UTSW 10 20970843 splice site probably benign
R1209:Ahi1 UTSW 10 20963730 missense probably damaging 0.98
R1364:Ahi1 UTSW 10 20972156 missense probably damaging 0.97
R1510:Ahi1 UTSW 10 20959800 missense probably benign 0.00
R1634:Ahi1 UTSW 10 20965693 missense probably damaging 1.00
R1789:Ahi1 UTSW 10 20963115 missense probably benign 0.18
R1818:Ahi1 UTSW 10 20988562 missense probably damaging 1.00
R2069:Ahi1 UTSW 10 20959996 missense probably damaging 0.98
R2148:Ahi1 UTSW 10 20970976 missense possibly damaging 0.64
R2566:Ahi1 UTSW 10 20970911 nonsense probably null
R2850:Ahi1 UTSW 10 21000593 missense probably benign 0.07
R2862:Ahi1 UTSW 10 20981408 missense probably damaging 0.99
R3969:Ahi1 UTSW 10 20959947 missense probably damaging 1.00
R4430:Ahi1 UTSW 10 20972078 missense probably damaging 1.00
R4496:Ahi1 UTSW 10 20965545 missense probably benign 0.07
R4755:Ahi1 UTSW 10 21055047 missense possibly damaging 0.94
R4916:Ahi1 UTSW 10 20984404 missense probably damaging 1.00
R5216:Ahi1 UTSW 10 20960076 missense probably benign 0.00
R5223:Ahi1 UTSW 10 20970919 missense possibly damaging 0.79
R5224:Ahi1 UTSW 10 20987022 missense probably damaging 1.00
R5604:Ahi1 UTSW 10 20987005 missense probably damaging 1.00
R5665:Ahi1 UTSW 10 21055047 missense possibly damaging 0.94
R5704:Ahi1 UTSW 10 21074427 missense probably benign
R5769:Ahi1 UTSW 10 20960082 critical splice donor site probably null
R5899:Ahi1 UTSW 10 21000566 missense probably benign 0.06
R5936:Ahi1 UTSW 10 20965933 missense probably damaging 1.00
R5969:Ahi1 UTSW 10 20984393 missense probably damaging 1.00
R6066:Ahi1 UTSW 10 20959926 missense possibly damaging 0.84
R6122:Ahi1 UTSW 10 21058165 missense probably benign 0.26
R6135:Ahi1 UTSW 10 20969121 missense probably benign 0.01
R6240:Ahi1 UTSW 10 20977081 missense probably damaging 1.00
R6387:Ahi1 UTSW 10 20969043 missense probably damaging 1.00
R6395:Ahi1 UTSW 10 20979592 missense possibly damaging 0.49
R6406:Ahi1 UTSW 10 20977049 missense probably damaging 1.00
R6440:Ahi1 UTSW 10 20960082 critical splice donor site probably benign
R6558:Ahi1 UTSW 10 20963673 missense probably damaging 1.00
R6744:Ahi1 UTSW 10 20965567 missense probably damaging 1.00
R6755:Ahi1 UTSW 10 21017913 missense probably damaging 0.98
R6927:Ahi1 UTSW 10 21055069 missense probably damaging 1.00
R6932:Ahi1 UTSW 10 20963691 missense probably benign 0.02
R6967:Ahi1 UTSW 10 20988625 missense probably damaging 0.98
R7168:Ahi1 UTSW 10 21017932 missense probably benign 0.01
R7169:Ahi1 UTSW 10 21055019 missense probably damaging 1.00
R7327:Ahi1 UTSW 10 20987077 missense probably damaging 0.99
R7351:Ahi1 UTSW 10 20965933 missense probably damaging 1.00
R7489:Ahi1 UTSW 10 20963750 missense probably benign 0.35
R7680:Ahi1 UTSW 10 21007768 missense possibly damaging 0.53
R7878:Ahi1 UTSW 10 20981431 critical splice donor site probably null
R7999:Ahi1 UTSW 10 20965681 missense probably benign 0.31
R8219:Ahi1 UTSW 10 21074436 missense probably benign 0.00
X0024:Ahi1 UTSW 10 21000592 missense possibly damaging 0.69
Z1177:Ahi1 UTSW 10 21041007 intron probably benign
Predicted Primers PCR Primer
(F):5'- AGGAAACCACTTCTGCACTG -3'
(R):5'- TCTGACTAACTTACTTGGGACTTC -3'

Sequencing Primer
(F):5'- CTGCACTGAAAAGAGAATTTCCTG -3'
(R):5'- GGGACTTCTTAAATTAAGACTTCGAG -3'
Posted On2020-07-28