Incidental Mutation 'R8248:Syn3'
ID640385
Institutional Source Beutler Lab
Gene Symbol Syn3
Ensembl Gene ENSMUSG00000059602
Gene Namesynapsin III
SynonymsSynapsin IIIa
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8248 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location86055125-86498896 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86135021 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 246 (I246F)
Ref Sequence ENSEMBL: ENSMUSP00000113720 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120638]
Predicted Effect probably benign
Transcript: ENSMUST00000120638
AA Change: I246F

PolyPhen 2 Score 0.133 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000113720
Gene: ENSMUSG00000059602
AA Change: I246F

DomainStartEndE-ValueType
Pfam:Synapsin_N 1 32 8.7e-22 PFAM
low complexity region 47 66 N/A INTRINSIC
low complexity region 80 88 N/A INTRINSIC
Pfam:Synapsin 89 190 1.8e-46 PFAM
Pfam:Synapsin_C 192 394 6.8e-141 PFAM
low complexity region 418 485 N/A INTRINSIC
low complexity region 535 551 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the synapsin gene family. Synapsins encode neuronal phosphoproteins which associate with the cytoplasmic surface of synaptic vesicles. Family members are characterized by common protein domains, and they are implicated in synaptogenesis and the modulation of neurotransmitter release, suggesting a potential role in several neuropsychiatric diseases. The protein encoded by this gene shares the synapsin family domain model, with domains A, C, and E exhibiting the highest degree of conservation. The protein contains a unique domain J, located between domains C and E. Based on this gene's localization to 22q12.3, a possible schizophrenia susceptibility locus, and the established neurobiological roles of the synapsins, this family member may represent a candidate gene for schizophrenia. The TIMP3 gene is located within an intron of this gene and is transcribed in the opposite direction. Alternative splicing of this gene results in multiple splice variants that encode different isoforms. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display altered neurotransmitter release, reduced synaptic depression, and a specific delay in early axon outgrowth in cultured hippocampal neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930003A15Rik T C 16: 19,883,806 D24G noncoding transcript Het
Adam32 A G 8: 24,901,470 S343P possibly damaging Het
Agbl2 G A 2: 90,797,564 G238R probably damaging Het
Ahi1 T A 10: 20,972,092 D466E probably benign Het
Ahnak T A 19: 9,001,946 V198E probably damaging Het
Ank2 T A 3: 126,937,785 H658L possibly damaging Het
Atp8b5 T A 4: 43,366,072 I781N probably damaging Het
Bloc1s6 A T 2: 122,742,645 R47* probably null Het
Clk2 G A 3: 89,173,504 V266M probably damaging Het
Cul9 A C 17: 46,530,014 Y777D probably damaging Het
Dcp1a C T 14: 30,479,598 probably benign Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Dnajb2 T G 1: 75,243,582 D248E Het
Dpy19l1 T C 9: 24,502,895 H79R probably benign Het
Elmo1 T C 13: 20,600,201 S643P probably damaging Het
Evi5 A G 5: 107,818,887 probably null Het
Fam76b T C 9: 13,831,102 C110R probably damaging Het
Galnt7 T A 8: 57,538,188 K429N probably benign Het
Gm10142 T A 10: 77,716,116 C104S probably damaging Het
Gm7298 A C 6: 121,787,443 H1427P probably benign Het
Golga7b A T 19: 42,266,871 I87F probably damaging Het
Gpr165 C A X: 96,714,017 D7E probably benign Het
Gpr25 C A 1: 136,260,677 R66L probably benign Het
H2-Q2 A G 17: 35,344,865 N241D probably benign Het
Il1a T C 2: 129,302,961 D179G probably benign Het
Itch T C 2: 155,206,383 probably null Het
Itsn2 T C 12: 4,662,052 V913A probably benign Het
Kdm1b T A 13: 47,071,878 probably benign Het
Lama4 T C 10: 39,061,379 I655T possibly damaging Het
Lats1 T A 10: 7,705,903 S817R probably damaging Het
Lrrc8c A T 5: 105,607,867 M503L probably benign Het
Mast4 T C 13: 102,738,721 T1380A probably damaging Het
Mfap1a G T 2: 121,506,495 T16K possibly damaging Het
Mroh2b C T 15: 4,931,104 T773I probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nudt7 A G 8: 114,151,997 Y255C probably benign Het
Pfas T C 11: 69,000,263 T310A probably damaging Het
Pkhd1l1 T G 15: 44,543,546 I2393R probably damaging Het
Pmm1 A C 15: 81,960,731 L24R possibly damaging Het
Pram1 T C 17: 33,641,164 V235A probably benign Het
Prg4 T C 1: 150,455,126 T599A unknown Het
Prpf40b A G 15: 99,316,285 K812E unknown Het
Qars G A 9: 108,509,452 A155T probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rgs6 A G 12: 83,137,704 probably benign Het
Rom1 T A 19: 8,928,681 R165W probably damaging Het
Rps6kb2 T A 19: 4,156,988 probably benign Het
Ryr1 A T 7: 29,069,121 W2808R probably damaging Het
Sh3gl1 A G 17: 56,019,038 probably null Het
Slc22a30 A T 19: 8,370,199 M279K probably benign Het
Snx11 A G 11: 96,769,933 S184P unknown Het
Srgap1 A G 10: 121,804,817 C692R probably damaging Het
Srgap3 T C 6: 112,723,143 N982S probably damaging Het
Stac T A 9: 111,593,745 D270V probably benign Het
Tnr T C 1: 159,892,093 V980A probably damaging Het
Usp17le G T 7: 104,769,794 A47E possibly damaging Het
Vmn2r118 T C 17: 55,610,936 N192S probably benign Het
Zmym4 C A 4: 126,905,369 V725L possibly damaging Het
Other mutations in Syn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Syn3 APN 10 86354416 missense probably damaging 1.00
IGL02391:Syn3 APN 10 86064906 missense probably benign 0.22
IGL02598:Syn3 APN 10 86467199 missense probably damaging 0.99
IGL03007:Syn3 APN 10 86064914 missense possibly damaging 0.57
IGL03379:Syn3 APN 10 86064872 missense possibly damaging 0.80
R0234:Syn3 UTSW 10 86448886 missense possibly damaging 0.64
R0234:Syn3 UTSW 10 86448886 missense possibly damaging 0.64
R1577:Syn3 UTSW 10 86448864 critical splice donor site probably null
R1597:Syn3 UTSW 10 86135044 missense probably benign 0.16
R1699:Syn3 UTSW 10 86080211 missense probably damaging 1.00
R1916:Syn3 UTSW 10 86354344 critical splice donor site probably null
R2006:Syn3 UTSW 10 86073233 missense probably benign 0.20
R2025:Syn3 UTSW 10 86466982 missense probably damaging 0.97
R4413:Syn3 UTSW 10 86055592 unclassified probably benign
R4904:Syn3 UTSW 10 86467086 missense possibly damaging 0.91
R5050:Syn3 UTSW 10 86407668 missense probably benign 0.05
R5286:Syn3 UTSW 10 86351564 missense possibly damaging 0.93
R5449:Syn3 UTSW 10 86351570 missense probably damaging 1.00
R5507:Syn3 UTSW 10 86080226 missense probably benign 0.01
R5792:Syn3 UTSW 10 86294628 makesense probably null
R6525:Syn3 UTSW 10 86467052 missense probably damaging 0.99
R6605:Syn3 UTSW 10 86057564 missense unknown
R7000:Syn3 UTSW 10 86080252 missense probably damaging 1.00
R7619:Syn3 UTSW 10 86057564 missense unknown
R7661:Syn3 UTSW 10 86069076 missense probably damaging 1.00
R7710:Syn3 UTSW 10 86407670 missense probably damaging 0.98
R7730:Syn3 UTSW 10 86448909 missense probably benign 0.05
R7798:Syn3 UTSW 10 86080253 missense probably damaging 1.00
R7819:Syn3 UTSW 10 86055540 unclassified probably benign
R7899:Syn3 UTSW 10 86064929 missense possibly damaging 0.94
R8342:Syn3 UTSW 10 86467027 missense probably damaging 0.99
X0023:Syn3 UTSW 10 86354477 missense probably benign 0.35
Z1177:Syn3 UTSW 10 86080209 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATTCAAGGTGATGTCCAGAGC -3'
(R):5'- ATAGCAGAGTGGCCTCCTAC -3'

Sequencing Primer
(F):5'- CATGCGTGCAAGCTTACAG -3'
(R):5'- CTCCTACAGAGGGGGATCC -3'
Posted On2020-07-28