Mutagenetix > Incidental Mutation

Incidental Mutation 'R8248:Pfas'

640387

Institutional Source

Beutler Lab

Gene Symbol

Pfas

Ensembl Gene

ENSMUSG00000020899

Gene Name

phosphoribosylformylglycinamidine synthase (FGAR amidotransferase)

Synonyms

4432409B16Rik, Sofa

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8248 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

68985697-69008460 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 69000263 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 310 (T310A)

Ref Sequence

ENSEMBL: ENSMUSP00000021282 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021282]

AlphaFold

Q5SUR0

Predicted Effect

probably damaging
Transcript: ENSMUST00000021282
AA Change: T310A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000021282
Gene: ENSMUSG00000020899
AA Change: T310A

Domain	Start	End	E-Value	Type
Pfam:AIRS_C	444	603	1.7e-21	PFAM
low complexity region	615	632	N/A	INTRINSIC
low complexity region	786	798	N/A	INTRINSIC
Pfam:AIRS_C	853	988	3e-11	PFAM
GATase_5	1061	1332	8.38e-133	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122573

Predicted Effect

probably benign
Transcript: ENSMUST00000149703

SMART Domains

Protein: ENSMUSP00000133984
Gene: ENSMUSG00000020899

Domain	Start	End	E-Value	Type
Pfam:AIRS_C	3	110	4e-12	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172987

Meta Mutation Damage Score

0.9603

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (60/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Purines are necessary for many cellular processes, including DNA replication, transcription, and energy metabolism. Ten enzymatic steps are required to synthesize inosine monophosphate (IMP) in the de novo pathway of purine biosynthesis. The enzyme encoded by this gene catalyzes the fourth step of IMP biosynthesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for spontaneous or ENU-induced mutations exhibit craniofacial abnormalities, most notably a domed cranium and short snout, variable white belly spots and white tail tips, and a range of eye defects including microphthalmia and anophthalmia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A930003A15Rik	T	C	16: 19,883,806	D24G	noncoding transcript	Het
Adam32	A	G	8: 24,901,470	S343P	possibly damaging	Het
Agbl2	G	A	2: 90,797,564	G238R	probably damaging	Het
Ahi1	T	A	10: 20,972,092	D466E	probably benign	Het
Ahnak	T	A	19: 9,001,946	V198E	probably damaging	Het
Ank2	T	A	3: 126,937,785	H658L	possibly damaging	Het
Atp8b5	T	A	4: 43,366,072	I781N	probably damaging	Het
Bloc1s6	A	T	2: 122,742,645	R47*	probably null	Het
Clk2	G	A	3: 89,173,504	V266M	probably damaging	Het
Cul9	A	C	17: 46,530,014	Y777D	probably damaging	Het
Dcp1a	C	T	14: 30,479,598		probably benign	Het
Dcp1a	A	G	14: 30,522,926	T570A	possibly damaging	Het
Dnajb2	T	G	1: 75,243,582	D248E		Het
Dpy19l1	T	C	9: 24,502,895	H79R	probably benign	Het
Elmo1	T	C	13: 20,600,201	S643P	probably damaging	Het
Evi5	A	G	5: 107,818,887		probably null	Het
Fam76b	T	C	9: 13,831,102	C110R	probably damaging	Het
Galnt7	T	A	8: 57,538,188	K429N	probably benign	Het
Gm10142	T	A	10: 77,716,116	C104S	probably damaging	Het
Gm7298	A	C	6: 121,787,443	H1427P	probably benign	Het
Golga7b	A	T	19: 42,266,871	I87F	probably damaging	Het
Gpr165	C	A	X: 96,714,017	D7E	probably benign	Het
Gpr25	C	A	1: 136,260,677	R66L	probably benign	Het
H2-Q2	A	G	17: 35,344,865	N241D	probably benign	Het
Il1a	T	C	2: 129,302,961	D179G	probably benign	Het
Itch	T	C	2: 155,206,383		probably null	Het
Itsn2	T	C	12: 4,662,052	V913A	probably benign	Het
Kdm1b	T	A	13: 47,071,878		probably benign	Het
Lama4	T	C	10: 39,061,379	I655T	possibly damaging	Het
Lats1	T	A	10: 7,705,903	S817R	probably damaging	Het
Lrrc8c	A	T	5: 105,607,867	M503L	probably benign	Het
Mast4	T	C	13: 102,738,721	T1380A	probably damaging	Het
Mfap1a	G	T	2: 121,506,495	T16K	possibly damaging	Het
Mroh2b	C	T	15: 4,931,104	T773I	probably benign	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Nudt7	A	G	8: 114,151,997	Y255C	probably benign	Het
Pkhd1l1	T	G	15: 44,543,546	I2393R	probably damaging	Het
Pmm1	A	C	15: 81,960,731	L24R	possibly damaging	Het
Pram1	T	C	17: 33,641,164	V235A	probably benign	Het
Prg4	T	C	1: 150,455,126	T599A	unknown	Het
Prpf40b	A	G	15: 99,316,285	K812E	unknown	Het
Qars	G	A	9: 108,509,452	A155T	probably benign	Het
Rftn1	G	T	17: 50,047,380	A318D	probably damaging	Het
Rgs6	A	G	12: 83,137,704		probably benign	Het
Rom1	T	A	19: 8,928,681	R165W	probably damaging	Het
Rps6kb2	T	A	19: 4,156,988		probably benign	Het
Ryr1	A	T	7: 29,069,121	W2808R	probably damaging	Het
Sh3gl1	A	G	17: 56,019,038		probably null	Het
Slc22a30	A	T	19: 8,370,199	M279K	probably benign	Het
Snx11	A	G	11: 96,769,933	S184P	unknown	Het
Srgap1	A	G	10: 121,804,817	C692R	probably damaging	Het
Srgap3	T	C	6: 112,723,143	N982S	probably damaging	Het
Stac	T	A	9: 111,593,745	D270V	probably benign	Het
Syn3	T	A	10: 86,135,021	I246F	probably benign	Het
Tnr	T	C	1: 159,892,093	V980A	probably damaging	Het
Usp17le	G	T	7: 104,769,794	A47E	possibly damaging	Het
Vmn2r118	T	C	17: 55,610,936	N192S	probably benign	Het
Zmym4	C	A	4: 126,905,369	V725L	possibly damaging	Het

Other mutations in Pfas

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00909:Pfas	APN	11	69003814	nonsense	probably null
IGL01287:Pfas	APN	11	69001260	missense	probably benign	0.09
IGL01712:Pfas	APN	11	68991060	missense	probably benign	0.34
IGL02019:Pfas	APN	11	68993463	unclassified	probably benign
IGL02053:Pfas	APN	11	68992953	missense	probably damaging	1.00
IGL02718:Pfas	APN	11	69000145	splice site	probably benign
IGL02801:Pfas	APN	11	68988277	unclassified	probably benign
Surf	UTSW	11	68988021	missense	probably damaging	1.00
PIT4812001:Pfas	UTSW	11	68990036	missense
R0037:Pfas	UTSW	11	69000036	missense	probably damaging	1.00
R0046:Pfas	UTSW	11	68990467	missense	probably benign
R0046:Pfas	UTSW	11	68990467	missense	probably benign
R0408:Pfas	UTSW	11	69001105	critical splice donor site	probably null
R0532:Pfas	UTSW	11	69002629	splice site	probably benign
R0707:Pfas	UTSW	11	68998037	missense	probably benign	0.00
R0783:Pfas	UTSW	11	69000521	missense	probably damaging	1.00
R0946:Pfas	UTSW	11	68993295	critical splice donor site	probably null
R0946:Pfas	UTSW	11	68990747	splice site	probably null
R1470:Pfas	UTSW	11	68991359	missense	probably benign
R1470:Pfas	UTSW	11	68991359	missense	probably benign
R1507:Pfas	UTSW	11	68990034	missense	probably benign	0.06
R1699:Pfas	UTSW	11	68998046	critical splice acceptor site	probably null
R1870:Pfas	UTSW	11	68991969	missense	probably damaging	1.00
R1871:Pfas	UTSW	11	68991969	missense	probably damaging	1.00
R1959:Pfas	UTSW	11	68994284	missense	probably damaging	1.00
R2026:Pfas	UTSW	11	68993957	missense	probably damaging	1.00
R2180:Pfas	UTSW	11	68992187	missense	possibly damaging	0.92
R3808:Pfas	UTSW	11	68989953	intron	probably benign
R3809:Pfas	UTSW	11	68989953	intron	probably benign
R3872:Pfas	UTSW	11	69000263	missense	probably damaging	1.00
R3906:Pfas	UTSW	11	68988286	unclassified	probably benign
R4092:Pfas	UTSW	11	68993949	missense	probably benign
R4437:Pfas	UTSW	11	68988417	missense	probably damaging	1.00
R4599:Pfas	UTSW	11	68991069	missense	probably benign	0.15
R4763:Pfas	UTSW	11	68990194	missense	possibly damaging	0.81
R5116:Pfas	UTSW	11	68990990	intron	probably benign
R5310:Pfas	UTSW	11	68988021	missense	probably damaging	1.00
R5328:Pfas	UTSW	11	68988592	missense	probably damaging	1.00
R5351:Pfas	UTSW	11	68991391	missense	probably damaging	1.00
R5427:Pfas	UTSW	11	69001153	missense	possibly damaging	0.90
R5533:Pfas	UTSW	11	68991470	missense	probably benign	0.02
R5602:Pfas	UTSW	11	68991045	missense	probably benign	0.05
R5637:Pfas	UTSW	11	68993323	missense	probably damaging	1.00
R5645:Pfas	UTSW	11	68991132	missense	probably damaging	1.00
R6149:Pfas	UTSW	11	68991945	missense	probably benign	0.07
R6295:Pfas	UTSW	11	68997999	missense	probably benign	0.36
R6305:Pfas	UTSW	11	69001197	missense	possibly damaging	0.51
R6387:Pfas	UTSW	11	69000465	missense	probably damaging	1.00
R6425:Pfas	UTSW	11	68991071	missense	probably benign	0.17
R6523:Pfas	UTSW	11	68990457	missense	probably benign
R6914:Pfas	UTSW	11	68992181	missense	probably benign	0.01
R6915:Pfas	UTSW	11	68992181	missense	probably benign	0.01
R6945:Pfas	UTSW	11	69000530	missense	probably benign
R6957:Pfas	UTSW	11	68993883	missense	probably benign	0.14
R7025:Pfas	UTSW	11	68990760	missense	probably benign	0.01
R7257:Pfas	UTSW	11	68992959	missense	probably damaging	1.00
R7386:Pfas	UTSW	11	69003774	missense	probably benign
R7424:Pfas	UTSW	11	69000092	missense	probably damaging	1.00
R7459:Pfas	UTSW	11	68988655	missense
R7593:Pfas	UTSW	11	68991095	missense
R7731:Pfas	UTSW	11	69000045	missense	probably damaging	1.00
R8103:Pfas	UTSW	11	68992293	missense	probably damaging	0.98
R8804:Pfas	UTSW	11	68991082	missense
R8853:Pfas	UTSW	11	68992918	missense	probably damaging	1.00
R9032:Pfas	UTSW	11	68988595	missense
R9050:Pfas	UTSW	11	68991741	missense	probably benign	0.01
R9283:Pfas	UTSW	11	68993882	missense	probably damaging	1.00
R9644:Pfas	UTSW	11	68992716	missense	probably benign	0.23
Z1176:Pfas	UTSW	11	68990070	missense
Z1176:Pfas	UTSW	11	69002487	missense	probably damaging	1.00
Z1177:Pfas	UTSW	11	68990225	missense	probably damaging	1.00
Z1177:Pfas	UTSW	11	69002493	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGCACTGGACGTCTCTGATG -3'
(R):5'- ATGAGCACTCAGGCATCCTC -3'

Sequencing Primer
(F):5'- ACGTCTCTGATGCGGCCAC -3'
(R):5'- AAGTCAAATTCCTGCGGC -3'

Posted On

2020-07-28