Incidental Mutation 'R8248:Pfas'
ID 640387
Institutional Source Beutler Lab
Gene Symbol Pfas
Ensembl Gene ENSMUSG00000020899
Gene Name phosphoribosylformylglycinamidine synthase (FGAR amidotransferase)
Synonyms 4432409B16Rik, Sofa
MMRRC Submission 067675-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8248 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 68876527-68899286 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 68891089 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 310 (T310A)
Ref Sequence ENSEMBL: ENSMUSP00000021282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021282]
AlphaFold Q5SUR0
Predicted Effect probably damaging
Transcript: ENSMUST00000021282
AA Change: T310A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021282
Gene: ENSMUSG00000020899
AA Change: T310A

DomainStartEndE-ValueType
Pfam:AIRS_C 444 603 1.7e-21 PFAM
low complexity region 615 632 N/A INTRINSIC
low complexity region 786 798 N/A INTRINSIC
Pfam:AIRS_C 853 988 3e-11 PFAM
GATase_5 1061 1332 8.38e-133 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122573
Predicted Effect probably benign
Transcript: ENSMUST00000149703
SMART Domains Protein: ENSMUSP00000133984
Gene: ENSMUSG00000020899

DomainStartEndE-ValueType
Pfam:AIRS_C 3 110 4e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172987
Meta Mutation Damage Score 0.9603 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Purines are necessary for many cellular processes, including DNA replication, transcription, and energy metabolism. Ten enzymatic steps are required to synthesize inosine monophosphate (IMP) in the de novo pathway of purine biosynthesis. The enzyme encoded by this gene catalyzes the fourth step of IMP biosynthesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for spontaneous or ENU-induced mutations exhibit craniofacial abnormalities, most notably a domed cranium and short snout, variable white belly spots and white tail tips, and a range of eye defects including microphthalmia and anophthalmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930003A15Rik T C 16: 19,702,556 (GRCm39) D24G noncoding transcript Het
Adam32 A G 8: 25,391,486 (GRCm39) S343P possibly damaging Het
Agbl2 G A 2: 90,627,908 (GRCm39) G238R probably damaging Het
Ahi1 T A 10: 20,847,991 (GRCm39) D466E probably benign Het
Ahnak T A 19: 8,979,310 (GRCm39) V198E probably damaging Het
Ank2 T A 3: 126,731,434 (GRCm39) H658L possibly damaging Het
Atp8b5 T A 4: 43,366,072 (GRCm39) I781N probably damaging Het
Bloc1s6 A T 2: 122,584,565 (GRCm39) R47* probably null Het
Clk2 G A 3: 89,080,811 (GRCm39) V266M probably damaging Het
Cul9 A C 17: 46,840,940 (GRCm39) Y777D probably damaging Het
Dcp1a A G 14: 30,244,883 (GRCm39) T570A possibly damaging Het
Dcp1a C T 14: 30,201,555 (GRCm39) probably benign Het
Dnajb2 T G 1: 75,220,226 (GRCm39) D248E Het
Dpy19l1 T C 9: 24,414,191 (GRCm39) H79R probably benign Het
Elmo1 T C 13: 20,784,371 (GRCm39) S643P probably damaging Het
Evi5 A G 5: 107,966,753 (GRCm39) probably null Het
Fam76b T C 9: 13,742,398 (GRCm39) C110R probably damaging Het
Galnt7 T A 8: 57,991,222 (GRCm39) K429N probably benign Het
Gm10142 T A 10: 77,551,950 (GRCm39) C104S probably damaging Het
Gm7298 A C 6: 121,764,402 (GRCm39) H1427P probably benign Het
Golga7b A T 19: 42,255,310 (GRCm39) I87F probably damaging Het
Gpr165 C A X: 95,757,623 (GRCm39) D7E probably benign Het
Gpr25 C A 1: 136,188,415 (GRCm39) R66L probably benign Het
H2-Q2 A G 17: 35,563,841 (GRCm39) N241D probably benign Het
Il1a T C 2: 129,144,881 (GRCm39) D179G probably benign Het
Itch T C 2: 155,048,303 (GRCm39) probably null Het
Itsn2 T C 12: 4,712,052 (GRCm39) V913A probably benign Het
Kdm1b T A 13: 47,225,354 (GRCm39) probably benign Het
Lama4 T C 10: 38,937,375 (GRCm39) I655T possibly damaging Het
Lats1 T A 10: 7,581,667 (GRCm39) S817R probably damaging Het
Lrrc8c A T 5: 105,755,733 (GRCm39) M503L probably benign Het
Mast4 T C 13: 102,875,229 (GRCm39) T1380A probably damaging Het
Mfap1a G T 2: 121,336,976 (GRCm39) T16K possibly damaging Het
Mroh2b C T 15: 4,960,586 (GRCm39) T773I probably benign Het
Myl10 G C 5: 136,726,825 (GRCm39) V70L probably benign Het
Nudt7 A G 8: 114,878,737 (GRCm39) Y255C probably benign Het
Pkhd1l1 T G 15: 44,406,942 (GRCm39) I2393R probably damaging Het
Pmm1 A C 15: 81,844,932 (GRCm39) L24R possibly damaging Het
Pram1 T C 17: 33,860,138 (GRCm39) V235A probably benign Het
Prg4 T C 1: 150,330,877 (GRCm39) T599A unknown Het
Prpf40b A G 15: 99,214,166 (GRCm39) K812E unknown Het
Qars1 G A 9: 108,386,651 (GRCm39) A155T probably benign Het
Rftn1 G T 17: 50,354,408 (GRCm39) A318D probably damaging Het
Rgs6 A G 12: 83,184,478 (GRCm39) probably benign Het
Rom1 T A 19: 8,906,045 (GRCm39) R165W probably damaging Het
Rps6kb2 T A 19: 4,206,987 (GRCm39) probably benign Het
Ryr1 A T 7: 28,768,546 (GRCm39) W2808R probably damaging Het
Sh3gl1 A G 17: 56,326,038 (GRCm39) probably null Het
Slc22a30 A T 19: 8,347,563 (GRCm39) M279K probably benign Het
Snx11 A G 11: 96,660,759 (GRCm39) S184P unknown Het
Srgap1 A G 10: 121,640,722 (GRCm39) C692R probably damaging Het
Srgap3 T C 6: 112,700,104 (GRCm39) N982S probably damaging Het
Stac T A 9: 111,422,813 (GRCm39) D270V probably benign Het
Syn3 T A 10: 85,970,885 (GRCm39) I246F probably benign Het
Tnr T C 1: 159,719,663 (GRCm39) V980A probably damaging Het
Usp17le G T 7: 104,419,001 (GRCm39) A47E possibly damaging Het
Vmn2r118 T C 17: 55,917,936 (GRCm39) N192S probably benign Het
Zmym4 C A 4: 126,799,162 (GRCm39) V725L possibly damaging Het
Other mutations in Pfas
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Pfas APN 11 68,894,640 (GRCm39) nonsense probably null
IGL01287:Pfas APN 11 68,892,086 (GRCm39) missense probably benign 0.09
IGL01712:Pfas APN 11 68,881,886 (GRCm39) missense probably benign 0.34
IGL02019:Pfas APN 11 68,884,289 (GRCm39) unclassified probably benign
IGL02053:Pfas APN 11 68,883,779 (GRCm39) missense probably damaging 1.00
IGL02718:Pfas APN 11 68,890,971 (GRCm39) splice site probably benign
IGL02801:Pfas APN 11 68,879,103 (GRCm39) unclassified probably benign
Surf UTSW 11 68,878,847 (GRCm39) missense probably damaging 1.00
PIT4812001:Pfas UTSW 11 68,880,862 (GRCm39) missense
R0037:Pfas UTSW 11 68,890,862 (GRCm39) missense probably damaging 1.00
R0046:Pfas UTSW 11 68,881,293 (GRCm39) missense probably benign
R0046:Pfas UTSW 11 68,881,293 (GRCm39) missense probably benign
R0408:Pfas UTSW 11 68,891,931 (GRCm39) critical splice donor site probably null
R0532:Pfas UTSW 11 68,893,455 (GRCm39) splice site probably benign
R0707:Pfas UTSW 11 68,888,863 (GRCm39) missense probably benign 0.00
R0783:Pfas UTSW 11 68,891,347 (GRCm39) missense probably damaging 1.00
R0946:Pfas UTSW 11 68,881,573 (GRCm39) splice site probably null
R0946:Pfas UTSW 11 68,884,121 (GRCm39) critical splice donor site probably null
R1470:Pfas UTSW 11 68,882,185 (GRCm39) missense probably benign
R1470:Pfas UTSW 11 68,882,185 (GRCm39) missense probably benign
R1507:Pfas UTSW 11 68,880,860 (GRCm39) missense probably benign 0.06
R1699:Pfas UTSW 11 68,888,872 (GRCm39) critical splice acceptor site probably null
R1870:Pfas UTSW 11 68,882,795 (GRCm39) missense probably damaging 1.00
R1871:Pfas UTSW 11 68,882,795 (GRCm39) missense probably damaging 1.00
R1959:Pfas UTSW 11 68,885,110 (GRCm39) missense probably damaging 1.00
R2026:Pfas UTSW 11 68,884,783 (GRCm39) missense probably damaging 1.00
R2180:Pfas UTSW 11 68,883,013 (GRCm39) missense possibly damaging 0.92
R3808:Pfas UTSW 11 68,880,779 (GRCm39) intron probably benign
R3809:Pfas UTSW 11 68,880,779 (GRCm39) intron probably benign
R3872:Pfas UTSW 11 68,891,089 (GRCm39) missense probably damaging 1.00
R3906:Pfas UTSW 11 68,879,112 (GRCm39) unclassified probably benign
R4092:Pfas UTSW 11 68,884,775 (GRCm39) missense probably benign
R4437:Pfas UTSW 11 68,879,243 (GRCm39) missense probably damaging 1.00
R4599:Pfas UTSW 11 68,881,895 (GRCm39) missense probably benign 0.15
R4763:Pfas UTSW 11 68,881,020 (GRCm39) missense possibly damaging 0.81
R5116:Pfas UTSW 11 68,881,816 (GRCm39) intron probably benign
R5310:Pfas UTSW 11 68,878,847 (GRCm39) missense probably damaging 1.00
R5328:Pfas UTSW 11 68,879,418 (GRCm39) missense probably damaging 1.00
R5351:Pfas UTSW 11 68,882,217 (GRCm39) missense probably damaging 1.00
R5427:Pfas UTSW 11 68,891,979 (GRCm39) missense possibly damaging 0.90
R5533:Pfas UTSW 11 68,882,296 (GRCm39) missense probably benign 0.02
R5602:Pfas UTSW 11 68,881,871 (GRCm39) missense probably benign 0.05
R5637:Pfas UTSW 11 68,884,149 (GRCm39) missense probably damaging 1.00
R5645:Pfas UTSW 11 68,881,958 (GRCm39) missense probably damaging 1.00
R6149:Pfas UTSW 11 68,882,771 (GRCm39) missense probably benign 0.07
R6295:Pfas UTSW 11 68,888,825 (GRCm39) missense probably benign 0.36
R6305:Pfas UTSW 11 68,892,023 (GRCm39) missense possibly damaging 0.51
R6387:Pfas UTSW 11 68,891,291 (GRCm39) missense probably damaging 1.00
R6425:Pfas UTSW 11 68,881,897 (GRCm39) missense probably benign 0.17
R6523:Pfas UTSW 11 68,881,283 (GRCm39) missense probably benign
R6914:Pfas UTSW 11 68,883,007 (GRCm39) missense probably benign 0.01
R6915:Pfas UTSW 11 68,883,007 (GRCm39) missense probably benign 0.01
R6945:Pfas UTSW 11 68,891,356 (GRCm39) missense probably benign
R6957:Pfas UTSW 11 68,884,709 (GRCm39) missense probably benign 0.14
R7025:Pfas UTSW 11 68,881,586 (GRCm39) missense probably benign 0.01
R7257:Pfas UTSW 11 68,883,785 (GRCm39) missense probably damaging 1.00
R7386:Pfas UTSW 11 68,894,600 (GRCm39) missense probably benign
R7424:Pfas UTSW 11 68,890,918 (GRCm39) missense probably damaging 1.00
R7459:Pfas UTSW 11 68,879,481 (GRCm39) missense
R7593:Pfas UTSW 11 68,881,921 (GRCm39) missense
R7731:Pfas UTSW 11 68,890,871 (GRCm39) missense probably damaging 1.00
R8103:Pfas UTSW 11 68,883,119 (GRCm39) missense probably damaging 0.98
R8804:Pfas UTSW 11 68,881,908 (GRCm39) missense
R8853:Pfas UTSW 11 68,883,744 (GRCm39) missense probably damaging 1.00
R9032:Pfas UTSW 11 68,879,421 (GRCm39) missense
R9050:Pfas UTSW 11 68,882,567 (GRCm39) missense probably benign 0.01
R9283:Pfas UTSW 11 68,884,708 (GRCm39) missense probably damaging 1.00
R9644:Pfas UTSW 11 68,883,542 (GRCm39) missense probably benign 0.23
Z1176:Pfas UTSW 11 68,893,313 (GRCm39) missense probably damaging 1.00
Z1176:Pfas UTSW 11 68,880,896 (GRCm39) missense
Z1177:Pfas UTSW 11 68,893,319 (GRCm39) nonsense probably null
Z1177:Pfas UTSW 11 68,881,051 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCACTGGACGTCTCTGATG -3'
(R):5'- ATGAGCACTCAGGCATCCTC -3'

Sequencing Primer
(F):5'- ACGTCTCTGATGCGGCCAC -3'
(R):5'- AAGTCAAATTCCTGCGGC -3'
Posted On 2020-07-28