Incidental Mutation 'R8248:Pfas'
ID640387
Institutional Source Beutler Lab
Gene Symbol Pfas
Ensembl Gene ENSMUSG00000020899
Gene Namephosphoribosylformylglycinamidine synthase (FGAR amidotransferase)
Synonyms4432409B16Rik, Sofa
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8248 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location68985697-69008460 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69000263 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 310 (T310A)
Ref Sequence ENSEMBL: ENSMUSP00000021282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021282]
Predicted Effect probably damaging
Transcript: ENSMUST00000021282
AA Change: T310A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021282
Gene: ENSMUSG00000020899
AA Change: T310A

DomainStartEndE-ValueType
Pfam:AIRS_C 444 603 1.7e-21 PFAM
low complexity region 615 632 N/A INTRINSIC
low complexity region 786 798 N/A INTRINSIC
Pfam:AIRS_C 853 988 3e-11 PFAM
GATase_5 1061 1332 8.38e-133 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122573
Predicted Effect probably benign
Transcript: ENSMUST00000149703
SMART Domains Protein: ENSMUSP00000133984
Gene: ENSMUSG00000020899

DomainStartEndE-ValueType
Pfam:AIRS_C 3 110 4e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172987
Meta Mutation Damage Score 0.9603 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Purines are necessary for many cellular processes, including DNA replication, transcription, and energy metabolism. Ten enzymatic steps are required to synthesize inosine monophosphate (IMP) in the de novo pathway of purine biosynthesis. The enzyme encoded by this gene catalyzes the fourth step of IMP biosynthesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for spontaneous or ENU-induced mutations exhibit craniofacial abnormalities, most notably a domed cranium and short snout, variable white belly spots and white tail tips, and a range of eye defects including microphthalmia and anophthalmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930003A15Rik T C 16: 19,883,806 D24G noncoding transcript Het
Adam32 A G 8: 24,901,470 S343P possibly damaging Het
Agbl2 G A 2: 90,797,564 G238R probably damaging Het
Ahi1 T A 10: 20,972,092 D466E probably benign Het
Ahnak T A 19: 9,001,946 V198E probably damaging Het
Ank2 T A 3: 126,937,785 H658L possibly damaging Het
Atp2b4 TTCTTC TTCTTCGTCTTC 1: 133,701,718 probably benign Het
Atp2b4 TCTTCT TCTTCTCCTTCT 1: 133,701,743 probably benign Het
Atp8b5 T A 4: 43,366,072 I781N probably damaging Het
Bloc1s6 A T 2: 122,742,645 R47* probably null Het
Clk2 G A 3: 89,173,504 V266M probably damaging Het
Cul9 A C 17: 46,530,014 Y777D probably damaging Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Dcp1a C T 14: 30,479,598 probably benign Het
Dnajb2 T G 1: 75,243,582 D248E Het
Dpy19l1 T C 9: 24,502,895 H79R probably benign Het
Elmo1 T C 13: 20,600,201 S643P probably damaging Het
Evi5 A G 5: 107,818,887 probably null Het
Fam76b T C 9: 13,831,102 C110R probably damaging Het
Galnt7 T A 8: 57,538,188 K429N probably benign Het
Gm10142 T A 10: 77,716,116 C104S probably damaging Het
Gm7298 A C 6: 121,787,443 H1427P probably benign Het
Golga7b A T 19: 42,266,871 I87F probably damaging Het
Gpr165 C A X: 96,714,017 D7E probably benign Het
Gpr25 C A 1: 136,260,677 R66L probably benign Het
H2-Q2 A G 17: 35,344,865 N241D probably benign Het
Il1a T C 2: 129,302,961 D179G probably benign Het
Itch T C 2: 155,206,383 probably null Het
Itsn2 T C 12: 4,662,052 V913A probably benign Het
Lama4 T C 10: 39,061,379 I655T possibly damaging Het
Lats1 T A 10: 7,705,903 S817R probably damaging Het
Lrrc8c A T 5: 105,607,867 M503L probably benign Het
Mast4 T C 13: 102,738,721 T1380A probably damaging Het
Mfap1a G T 2: 121,506,495 T16K possibly damaging Het
Mroh2b C T 15: 4,931,104 T773I probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nudt7 A G 8: 114,151,997 Y255C probably benign Het
Pkhd1l1 T G 15: 44,543,546 I2393R probably damaging Het
Pmm1 A C 15: 81,960,731 L24R possibly damaging Het
Pram1 T C 17: 33,641,164 V235A probably benign Het
Prg4 T C 1: 150,455,126 T599A unknown Het
Prpf40b A G 15: 99,316,285 K812E unknown Het
Qars G A 9: 108,509,452 A155T probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rom1 T A 19: 8,928,681 R165W probably damaging Het
Ryr1 A T 7: 29,069,121 W2808R probably damaging Het
Sh3gl1 A G 17: 56,019,038 probably null Het
Slc22a30 A T 19: 8,370,199 M279K probably benign Het
Snx11 A G 11: 96,769,933 S184P unknown Het
Srgap1 A G 10: 121,804,817 C692R probably damaging Het
Srgap3 T C 6: 112,723,143 N982S probably damaging Het
Stac T A 9: 111,593,745 D270V probably benign Het
Syn3 T A 10: 86,135,021 I246F probably benign Het
Tnr T C 1: 159,892,093 V980A probably damaging Het
Usp17le G T 7: 104,769,794 A47E possibly damaging Het
Vmn2r118 T C 17: 55,610,936 N192S probably benign Het
Zmym4 C A 4: 126,905,369 V725L possibly damaging Het
Other mutations in Pfas
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Pfas APN 11 69003814 nonsense probably null
IGL01287:Pfas APN 11 69001260 missense probably benign 0.09
IGL01712:Pfas APN 11 68991060 missense probably benign 0.34
IGL02019:Pfas APN 11 68993463 unclassified probably benign
IGL02053:Pfas APN 11 68992953 missense probably damaging 1.00
IGL02718:Pfas APN 11 69000145 splice site probably benign
IGL02801:Pfas APN 11 68988277 unclassified probably benign
Surf UTSW 11 68988021 missense probably damaging 1.00
PIT4812001:Pfas UTSW 11 68990036 missense
R0037:Pfas UTSW 11 69000036 missense probably damaging 1.00
R0046:Pfas UTSW 11 68990467 missense probably benign
R0046:Pfas UTSW 11 68990467 missense probably benign
R0408:Pfas UTSW 11 69001105 critical splice donor site probably null
R0532:Pfas UTSW 11 69002629 splice site probably benign
R0707:Pfas UTSW 11 68998037 missense probably benign 0.00
R0783:Pfas UTSW 11 69000521 missense probably damaging 1.00
R0946:Pfas UTSW 11 68993295 critical splice donor site probably null
R0946:Pfas UTSW 11 68990747 splice site probably null
R1470:Pfas UTSW 11 68991359 missense probably benign
R1470:Pfas UTSW 11 68991359 missense probably benign
R1507:Pfas UTSW 11 68990034 missense probably benign 0.06
R1699:Pfas UTSW 11 68998046 critical splice acceptor site probably null
R1870:Pfas UTSW 11 68991969 missense probably damaging 1.00
R1871:Pfas UTSW 11 68991969 missense probably damaging 1.00
R1959:Pfas UTSW 11 68994284 missense probably damaging 1.00
R2026:Pfas UTSW 11 68993957 missense probably damaging 1.00
R2180:Pfas UTSW 11 68992187 missense possibly damaging 0.92
R3808:Pfas UTSW 11 68989953 intron probably benign
R3809:Pfas UTSW 11 68989953 intron probably benign
R3872:Pfas UTSW 11 69000263 missense probably damaging 1.00
R3906:Pfas UTSW 11 68988286 unclassified probably benign
R4092:Pfas UTSW 11 68993949 missense probably benign
R4437:Pfas UTSW 11 68988417 missense probably damaging 1.00
R4599:Pfas UTSW 11 68991069 missense probably benign 0.15
R4763:Pfas UTSW 11 68990194 missense possibly damaging 0.81
R5116:Pfas UTSW 11 68990990 intron probably benign
R5310:Pfas UTSW 11 68988021 missense probably damaging 1.00
R5328:Pfas UTSW 11 68988592 missense probably damaging 1.00
R5351:Pfas UTSW 11 68991391 missense probably damaging 1.00
R5427:Pfas UTSW 11 69001153 missense possibly damaging 0.90
R5533:Pfas UTSW 11 68991470 missense probably benign 0.02
R5602:Pfas UTSW 11 68991045 missense probably benign 0.05
R5637:Pfas UTSW 11 68993323 missense probably damaging 1.00
R5645:Pfas UTSW 11 68991132 missense probably damaging 1.00
R6149:Pfas UTSW 11 68991945 missense probably benign 0.07
R6295:Pfas UTSW 11 68997999 missense probably benign 0.36
R6305:Pfas UTSW 11 69001197 missense possibly damaging 0.51
R6387:Pfas UTSW 11 69000465 missense probably damaging 1.00
R6425:Pfas UTSW 11 68991071 missense probably benign 0.17
R6523:Pfas UTSW 11 68990457 missense probably benign
R6914:Pfas UTSW 11 68992181 missense probably benign 0.01
R6915:Pfas UTSW 11 68992181 missense probably benign 0.01
R6945:Pfas UTSW 11 69000530 missense probably benign
R6957:Pfas UTSW 11 68993883 missense probably benign 0.14
R7025:Pfas UTSW 11 68990760 missense probably benign 0.01
R7257:Pfas UTSW 11 68992959 missense probably damaging 1.00
R7386:Pfas UTSW 11 69003774 missense probably benign
R7424:Pfas UTSW 11 69000092 missense probably damaging 1.00
R7459:Pfas UTSW 11 68988655 missense
R7593:Pfas UTSW 11 68991095 missense
R7731:Pfas UTSW 11 69000045 missense probably damaging 1.00
R8103:Pfas UTSW 11 68992293 missense probably damaging 0.98
Z1176:Pfas UTSW 11 68990070 missense
Z1176:Pfas UTSW 11 69002487 missense probably damaging 1.00
Z1177:Pfas UTSW 11 68990225 missense probably damaging 1.00
Z1177:Pfas UTSW 11 69002493 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCACTGGACGTCTCTGATG -3'
(R):5'- ATGAGCACTCAGGCATCCTC -3'

Sequencing Primer
(F):5'- ACGTCTCTGATGCGGCCAC -3'
(R):5'- AAGTCAAATTCCTGCGGC -3'
Posted On2020-07-28