Incidental Mutation 'R0095:Naip1'
ID64039
Institutional Source Beutler Lab
Gene Symbol Naip1
Ensembl Gene ENSMUSG00000021640
Gene NameNLR family, apoptosis inhibitory protein 1
SynonymsBirc1a, D13Lsd1, Naip
MMRRC Submission 038381-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0095 (G1)
Quality Score83
Status Not validated
Chromosome13
Chromosomal Location100407764-100452869 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100423083 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1138 (T1138A)
Ref Sequence ENSEMBL: ENSMUSP00000152583 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022142] [ENSMUST00000221727] [ENSMUST00000221943] [ENSMUST00000222155]
Predicted Effect probably benign
Transcript: ENSMUST00000022142
AA Change: T1138A

PolyPhen 2 Score 0.237 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000022142
Gene: ENSMUSG00000021640
AA Change: T1138A

DomainStartEndE-ValueType
low complexity region 36 51 N/A INTRINSIC
BIR 58 129 1.18e-20 SMART
BIR 157 229 1.06e-36 SMART
BIR 276 347 7.82e-26 SMART
AAA 462 603 1.14e-2 SMART
low complexity region 908 919 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000221727
Predicted Effect probably benign
Transcript: ENSMUST00000221943
Predicted Effect probably benign
Transcript: ENSMUST00000222155
AA Change: T1138A

PolyPhen 2 Score 0.237 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anxa8 G A 14: 34,086,071 A6T probably benign Het
Bicc1 T A 10: 70,961,158 I42F probably damaging Het
Cutc T C 19: 43,753,199 W13R probably benign Het
F5 A T 1: 164,191,968 R671* probably null Het
Fam84b T C 15: 60,823,576 Y107C probably damaging Het
Fer A T 17: 63,941,326 E361V possibly damaging Het
Hnrnpa3 G T 2: 75,661,696 R52L probably damaging Het
Igsf10 A T 3: 59,331,196 Y521* probably null Het
Mmp1a G A 9: 7,465,620 G186D possibly damaging Het
Necab1 T A 4: 14,960,027 N307Y possibly damaging Het
Olfr510 A C 7: 108,668,045 I210L probably benign Het
Plekha5 T C 6: 140,528,597 F84L probably damaging Het
Rpl6 T G 5: 121,205,839 V115G possibly damaging Het
Sec16a A T 2: 26,425,760 probably null Het
Tpsg1 T C 17: 25,372,554 W43R probably damaging Het
Unc45a T C 7: 80,329,543 D567G probably damaging Het
Usp30 T A 5: 114,105,840 F157I probably damaging Het
Zfp345 T A 2: 150,472,300 H439L probably damaging Het
Other mutations in Naip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01115:Naip1 APN 13 100443720 critical splice acceptor site probably null
IGL01145:Naip1 APN 13 100409121 missense probably benign 0.00
IGL01356:Naip1 APN 13 100423214 missense probably damaging 0.99
IGL01414:Naip1 APN 13 100409173 critical splice acceptor site probably null
IGL01505:Naip1 APN 13 100425933 missense probably damaging 1.00
IGL01573:Naip1 APN 13 100427382 missense probably benign 0.03
IGL01931:Naip1 APN 13 100409032 nonsense probably null
IGL02043:Naip1 APN 13 100426796 missense probably benign 0.03
IGL02097:Naip1 APN 13 100425588 missense probably benign 0.03
IGL02331:Naip1 APN 13 100426796 missense probably benign 0.03
IGL02627:Naip1 APN 13 100425648 missense possibly damaging 0.68
IGL02675:Naip1 APN 13 100409118 missense probably benign
IGL02801:Naip1 APN 13 100444368 missense probably damaging 1.00
IGL02851:Naip1 APN 13 100433262 missense probably damaging 1.00
IGL03038:Naip1 APN 13 100437333 nonsense probably null
IGL03399:Naip1 APN 13 100408918 missense probably damaging 1.00
FR4340:Naip1 UTSW 13 100423076 missense probably benign
FR4342:Naip1 UTSW 13 100425471 missense probably benign 0.00
R0051:Naip1 UTSW 13 100411001 missense probably damaging 0.96
R0147:Naip1 UTSW 13 100426910 missense possibly damaging 0.67
R0375:Naip1 UTSW 13 100409148 missense probably benign 0.21
R0442:Naip1 UTSW 13 100444516 missense probably benign 0.00
R0455:Naip1 UTSW 13 100423219 missense probably benign 0.00
R0491:Naip1 UTSW 13 100423219 missense probably benign 0.00
R0614:Naip1 UTSW 13 100444200 missense probably benign 0.00
R0785:Naip1 UTSW 13 100423076 missense probably benign
R0785:Naip1 UTSW 13 100423085 missense probably benign 0.00
R0787:Naip1 UTSW 13 100426096 missense probably benign 0.22
R1081:Naip1 UTSW 13 100423070 missense probably benign 0.21
R1177:Naip1 UTSW 13 100427064 missense possibly damaging 0.91
R1476:Naip1 UTSW 13 100426870 missense probably benign 0.35
R1672:Naip1 UTSW 13 100423149 missense probably benign 0.00
R1809:Naip1 UTSW 13 100426239 missense probably benign
R2057:Naip1 UTSW 13 100425573 missense probably damaging 0.96
R2182:Naip1 UTSW 13 100413680 missense probably benign 0.01
R2395:Naip1 UTSW 13 100423106 missense possibly damaging 0.83
R2518:Naip1 UTSW 13 100423219 missense probably benign 0.00
R3033:Naip1 UTSW 13 100432458 missense probably benign 0.01
R3122:Naip1 UTSW 13 100408995 missense probably damaging 1.00
R3439:Naip1 UTSW 13 100423219 missense probably benign 0.00
R4167:Naip1 UTSW 13 100444286 missense probably benign 0.04
R4179:Naip1 UTSW 13 100426176 missense probably damaging 0.99
R4212:Naip1 UTSW 13 100426875 splice site probably null
R4639:Naip1 UTSW 13 100444283 missense probably benign 0.31
R4674:Naip1 UTSW 13 100444174 missense probably damaging 1.00
R4736:Naip1 UTSW 13 100444526 missense possibly damaging 0.47
R4740:Naip1 UTSW 13 100444526 missense possibly damaging 0.47
R4778:Naip1 UTSW 13 100426648 missense probably damaging 1.00
R4806:Naip1 UTSW 13 100425621 missense probably benign 0.00
R4855:Naip1 UTSW 13 100423220 splice site probably null
R5740:Naip1 UTSW 13 100432501 critical splice acceptor site probably null
R5797:Naip1 UTSW 13 100444526 missense possibly damaging 0.47
R5806:Naip1 UTSW 13 100444735 start codon destroyed probably null 1.00
R5895:Naip1 UTSW 13 100423128 missense probably benign 0.00
R5896:Naip1 UTSW 13 100423128 missense probably benign 0.00
R6023:Naip1 UTSW 13 100426186 missense probably benign 0.00
R6109:Naip1 UTSW 13 100427182 missense probably damaging 1.00
R6117:Naip1 UTSW 13 100444737 start codon destroyed probably damaging 0.99
R6133:Naip1 UTSW 13 100444643 missense probably benign 0.10
R6241:Naip1 UTSW 13 100425661 missense probably damaging 0.99
R6335:Naip1 UTSW 13 100426552 missense probably damaging 1.00
R6404:Naip1 UTSW 13 100423219 missense probably benign 0.00
R6475:Naip1 UTSW 13 100409088 missense probably damaging 1.00
R6508:Naip1 UTSW 13 100436465 missense probably damaging 1.00
R6580:Naip1 UTSW 13 100444649 missense probably damaging 0.99
R6600:Naip1 UTSW 13 100423070 missense probably benign 0.21
R6600:Naip1 UTSW 13 100423158 missense probably benign 0.00
R6603:Naip1 UTSW 13 100423070 missense probably benign 0.21
R6603:Naip1 UTSW 13 100423158 missense probably benign 0.00
R6633:Naip1 UTSW 13 100423076 missense probably benign
R6633:Naip1 UTSW 13 100423085 missense probably benign 0.00
R6720:Naip1 UTSW 13 100423077 missense probably benign 0.00
R6805:Naip1 UTSW 13 100427341 missense probably benign 0.04
R7043:Naip1 UTSW 13 100426914 missense probably damaging 1.00
R7615:Naip1 UTSW 13 100425776 missense probably benign 0.00
R7797:Naip1 UTSW 13 100444478 missense probably damaging 1.00
R7820:Naip1 UTSW 13 100423070 missense probably benign 0.21
R7842:Naip1 UTSW 13 100426998 missense probably damaging 1.00
R8117:Naip1 UTSW 13 100427001 missense possibly damaging 0.67
R8132:Naip1 UTSW 13 100437375 missense possibly damaging 0.84
R8177:Naip1 UTSW 13 100427403 missense probably benign 0.00
R8203:Naip1 UTSW 13 100425820 missense probably benign 0.02
R8283:Naip1 UTSW 13 100427187 missense probably damaging 1.00
R8319:Naip1 UTSW 13 100429213 missense probably benign 0.13
R8377:Naip1 UTSW 13 100425866 missense possibly damaging 0.53
RF007:Naip1 UTSW 13 100426134 missense probably benign 0.03
X0066:Naip1 UTSW 13 100437322 missense probably damaging 1.00
Y4335:Naip1 UTSW 13 100425522 missense probably benign 0.00
Y4336:Naip1 UTSW 13 100425522 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCTGATAGCCTGAGCAGTCAATG -3'
(R):5'- GCTGAAGCACCTTGAGAACTTGCAC -3'

Sequencing Primer
(F):5'- acagtgggtatgaggagagag -3'
(R):5'- AGAACTTGCACTTGGGGC -3'
Posted On2013-08-06