Incidental Mutation 'R8248:Mroh2b'
ID640394
Institutional Source Beutler Lab
Gene Symbol Mroh2b
Ensembl Gene ENSMUSG00000022155
Gene Namemaestro heat-like repeat family member 2B
Synonyms4930455B06Rik, Heatr7b2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R8248 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location4898737-4962205 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 4931104 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 773 (T773I)
Ref Sequence ENSEMBL: ENSMUSP00000036148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045736]
Predicted Effect probably benign
Transcript: ENSMUST00000045736
AA Change: T773I

PolyPhen 2 Score 0.395 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000036148
Gene: ENSMUSG00000022155
AA Change: T773I

DomainStartEndE-ValueType
low complexity region 124 135 N/A INTRINSIC
low complexity region 824 842 N/A INTRINSIC
SCOP:d1gw5a_ 937 1443 7e-15 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930003A15Rik T C 16: 19,883,806 D24G noncoding transcript Het
Adam32 A G 8: 24,901,470 S343P possibly damaging Het
Agbl2 G A 2: 90,797,564 G238R probably damaging Het
Ahi1 T A 10: 20,972,092 D466E probably benign Het
Ahnak T A 19: 9,001,946 V198E probably damaging Het
Ank2 T A 3: 126,937,785 H658L possibly damaging Het
Atp8b5 T A 4: 43,366,072 I781N probably damaging Het
Bloc1s6 A T 2: 122,742,645 R47* probably null Het
Clk2 G A 3: 89,173,504 V266M probably damaging Het
Cul9 A C 17: 46,530,014 Y777D probably damaging Het
Dcp1a C T 14: 30,479,598 probably benign Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Dnajb2 T G 1: 75,243,582 D248E Het
Dpy19l1 T C 9: 24,502,895 H79R probably benign Het
Elmo1 T C 13: 20,600,201 S643P probably damaging Het
Evi5 A G 5: 107,818,887 probably null Het
Fam76b T C 9: 13,831,102 C110R probably damaging Het
Galnt7 T A 8: 57,538,188 K429N probably benign Het
Gm10142 T A 10: 77,716,116 C104S probably damaging Het
Gm7298 A C 6: 121,787,443 H1427P probably benign Het
Golga7b A T 19: 42,266,871 I87F probably damaging Het
Gpr165 C A X: 96,714,017 D7E probably benign Het
Gpr25 C A 1: 136,260,677 R66L probably benign Het
H2-Q2 A G 17: 35,344,865 N241D probably benign Het
Il1a T C 2: 129,302,961 D179G probably benign Het
Itch T C 2: 155,206,383 probably null Het
Itsn2 T C 12: 4,662,052 V913A probably benign Het
Kdm1b T A 13: 47,071,878 probably benign Het
Lama4 T C 10: 39,061,379 I655T possibly damaging Het
Lats1 T A 10: 7,705,903 S817R probably damaging Het
Lrrc8c A T 5: 105,607,867 M503L probably benign Het
Mast4 T C 13: 102,738,721 T1380A probably damaging Het
Mfap1a G T 2: 121,506,495 T16K possibly damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nudt7 A G 8: 114,151,997 Y255C probably benign Het
Pfas T C 11: 69,000,263 T310A probably damaging Het
Pkhd1l1 T G 15: 44,543,546 I2393R probably damaging Het
Pmm1 A C 15: 81,960,731 L24R possibly damaging Het
Pram1 T C 17: 33,641,164 V235A probably benign Het
Prg4 T C 1: 150,455,126 T599A unknown Het
Prpf40b A G 15: 99,316,285 K812E unknown Het
Qars G A 9: 108,509,452 A155T probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rgs6 A G 12: 83,137,704 probably benign Het
Rom1 T A 19: 8,928,681 R165W probably damaging Het
Rps6kb2 T A 19: 4,156,988 probably benign Het
Ryr1 A T 7: 29,069,121 W2808R probably damaging Het
Sh3gl1 A G 17: 56,019,038 probably null Het
Slc22a30 A T 19: 8,370,199 M279K probably benign Het
Snx11 A G 11: 96,769,933 S184P unknown Het
Srgap1 A G 10: 121,804,817 C692R probably damaging Het
Srgap3 T C 6: 112,723,143 N982S probably damaging Het
Stac T A 9: 111,593,745 D270V probably benign Het
Syn3 T A 10: 86,135,021 I246F probably benign Het
Tnr T C 1: 159,892,093 V980A probably damaging Het
Usp17le G T 7: 104,769,794 A47E possibly damaging Het
Vmn2r118 T C 17: 55,610,936 N192S probably benign Het
Zmym4 C A 4: 126,905,369 V725L possibly damaging Het
Other mutations in Mroh2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Mroh2b APN 15 4899197 missense probably benign
IGL00507:Mroh2b APN 15 4962127 missense probably damaging 1.00
IGL00548:Mroh2b APN 15 4931316 missense probably benign 0.35
IGL00902:Mroh2b APN 15 4915222 missense probably damaging 1.00
IGL00944:Mroh2b APN 15 4951127 splice site probably benign
IGL00954:Mroh2b APN 15 4903054 missense probably damaging 0.99
IGL01015:Mroh2b APN 15 4941542 missense probably damaging 1.00
IGL01134:Mroh2b APN 15 4915152 missense probably benign 0.00
IGL01337:Mroh2b APN 15 4905024 missense probably benign 0.38
IGL01780:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL01919:Mroh2b APN 15 4923688 missense probably benign 0.10
IGL02069:Mroh2b APN 15 4904324 splice site probably benign
IGL02146:Mroh2b APN 15 4951294 splice site probably null
IGL02221:Mroh2b APN 15 4923641 missense probably damaging 1.00
IGL02281:Mroh2b APN 15 4952263 missense probably benign 0.04
IGL02350:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL02357:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL02401:Mroh2b APN 15 4900501 missense possibly damaging 0.71
IGL02427:Mroh2b APN 15 4951560 splice site probably benign
IGL02432:Mroh2b APN 15 4914186 missense probably benign
IGL02582:Mroh2b APN 15 4908515 missense probably damaging 0.98
IGL02632:Mroh2b APN 15 4931101 missense probably damaging 0.99
IGL02741:Mroh2b APN 15 4905632 missense probably benign
IGL02811:Mroh2b APN 15 4915236 missense possibly damaging 0.55
IGL02826:Mroh2b APN 15 4962148 missense probably damaging 0.99
IGL03412:Mroh2b APN 15 4944372 missense probably benign 0.14
PIT4468001:Mroh2b UTSW 15 4912812 missense probably damaging 1.00
R0024:Mroh2b UTSW 15 4925627 missense probably damaging 1.00
R0333:Mroh2b UTSW 15 4931118 missense probably damaging 1.00
R0433:Mroh2b UTSW 15 4941634 missense probably benign 0.01
R0530:Mroh2b UTSW 15 4934395 missense probably damaging 0.97
R1411:Mroh2b UTSW 15 4918317 missense probably damaging 1.00
R1457:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1466:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1466:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1472:Mroh2b UTSW 15 4948655 missense probably benign 0.00
R1525:Mroh2b UTSW 15 4951130 splice site probably null
R1584:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1605:Mroh2b UTSW 15 4945090 missense probably benign 0.08
R1657:Mroh2b UTSW 15 4931043 nonsense probably null
R1671:Mroh2b UTSW 15 4951294 splice site probably null
R1698:Mroh2b UTSW 15 4914140 missense probably benign 0.02
R2002:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R2005:Mroh2b UTSW 15 4917158 missense probably damaging 1.00
R2077:Mroh2b UTSW 15 4944966 missense probably damaging 1.00
R2179:Mroh2b UTSW 15 4921446 critical splice donor site probably null
R2183:Mroh2b UTSW 15 4918225 splice site probably null
R3713:Mroh2b UTSW 15 4943649 missense probably benign 0.01
R3714:Mroh2b UTSW 15 4943649 missense probably benign 0.01
R3747:Mroh2b UTSW 15 4952246 nonsense probably null
R3748:Mroh2b UTSW 15 4952246 nonsense probably null
R3749:Mroh2b UTSW 15 4952246 nonsense probably null
R3750:Mroh2b UTSW 15 4952246 nonsense probably null
R3792:Mroh2b UTSW 15 4923620 missense probably damaging 1.00
R3872:Mroh2b UTSW 15 4925061 nonsense probably null
R4021:Mroh2b UTSW 15 4925100 missense possibly damaging 0.75
R4329:Mroh2b UTSW 15 4931379 missense probably damaging 0.99
R4456:Mroh2b UTSW 15 4947925 missense probably benign 0.21
R4592:Mroh2b UTSW 15 4918290 missense probably damaging 1.00
R4836:Mroh2b UTSW 15 4904270 missense probably damaging 1.00
R5050:Mroh2b UTSW 15 4900450 missense possibly damaging 0.82
R5230:Mroh2b UTSW 15 4941522 missense probably benign 0.07
R5342:Mroh2b UTSW 15 4914133 nonsense probably null
R5353:Mroh2b UTSW 15 4917178 missense probably damaging 1.00
R5368:Mroh2b UTSW 15 4905572 missense probably damaging 1.00
R5424:Mroh2b UTSW 15 4941612 missense probably damaging 0.98
R5484:Mroh2b UTSW 15 4908981 missense possibly damaging 0.92
R5999:Mroh2b UTSW 15 4912884 splice site probably null
R6046:Mroh2b UTSW 15 4951281 missense probably benign 0.01
R6081:Mroh2b UTSW 15 4944377 missense probably damaging 1.00
R6162:Mroh2b UTSW 15 4915225 missense probably damaging 1.00
R6165:Mroh2b UTSW 15 4918350 missense probably benign 0.23
R6240:Mroh2b UTSW 15 4934644 missense probably benign 0.38
R6487:Mroh2b UTSW 15 4947239 missense probably damaging 1.00
R6539:Mroh2b UTSW 15 4905574 missense probably damaging 1.00
R6616:Mroh2b UTSW 15 4953282 missense probably benign 0.36
R6663:Mroh2b UTSW 15 4947935 missense probably benign 0.21
R6820:Mroh2b UTSW 15 4953274 missense probably damaging 1.00
R6900:Mroh2b UTSW 15 4908987 missense probably benign 0.00
R6990:Mroh2b UTSW 15 4912802 missense possibly damaging 0.55
R7067:Mroh2b UTSW 15 4900504 missense probably benign 0.35
R7092:Mroh2b UTSW 15 4934678 missense possibly damaging 0.92
R7102:Mroh2b UTSW 15 4948003 missense probably benign 0.06
R7264:Mroh2b UTSW 15 4921362 missense possibly damaging 0.81
R7436:Mroh2b UTSW 15 4941554 missense probably benign 0.21
R7462:Mroh2b UTSW 15 4908627 missense probably damaging 1.00
R7529:Mroh2b UTSW 15 4949009 missense probably damaging 1.00
R7575:Mroh2b UTSW 15 4934605 missense probably damaging 1.00
R7579:Mroh2b UTSW 15 4931061 missense probably benign 0.09
R7605:Mroh2b UTSW 15 4945023 missense probably damaging 1.00
R7624:Mroh2b UTSW 15 4917131 missense probably damaging 1.00
R7797:Mroh2b UTSW 15 4949105 missense probably benign 0.36
R7848:Mroh2b UTSW 15 4938379 nonsense probably null
R7952:Mroh2b UTSW 15 4951211 missense probably damaging 1.00
R7995:Mroh2b UTSW 15 4921357 nonsense probably null
R8088:Mroh2b UTSW 15 4900503 missense possibly damaging 0.57
R8207:Mroh2b UTSW 15 4938410 missense possibly damaging 0.95
R8242:Mroh2b UTSW 15 4909040 missense probably benign 0.04
R8258:Mroh2b UTSW 15 4911909 missense probably benign 0.01
R8259:Mroh2b UTSW 15 4911909 missense probably benign 0.01
R8304:Mroh2b UTSW 15 4925637 missense probably damaging 0.99
R8316:Mroh2b UTSW 15 4951264 nonsense probably null
R8345:Mroh2b UTSW 15 4944326 missense probably benign 0.09
R8507:Mroh2b UTSW 15 4949090 missense probably damaging 1.00
X0067:Mroh2b UTSW 15 4951591 missense possibly damaging 0.90
Z1177:Mroh2b UTSW 15 4905005 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTACTGAGACCCTAGGTGAAG -3'
(R):5'- TTTCCAGCGAACAGGACTGG -3'

Sequencing Primer
(F):5'- TACTGAGACCCTAGGTGAAGAGTGG -3'
(R):5'- TCAGGGGTTCATCCTTTATCAAG -3'
Posted On2020-07-28