Incidental Mutation 'R8248:Prpf40b'
ID640397
Institutional Source Beutler Lab
Gene Symbol Prpf40b
Ensembl Gene ENSMUSG00000023007
Gene Namepre-mRNA processing factor 40B
Synonyms2610317D23Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.180) question?
Stock #R8248 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location99295087-99317018 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99316285 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 812 (K812E)
Ref Sequence ENSEMBL: ENSMUSP00000115869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023745] [ENSMUST00000081224] [ENSMUST00000088233] [ENSMUST00000118287] [ENSMUST00000120633] [ENSMUST00000126955] [ENSMUST00000136980] [ENSMUST00000145482] [ENSMUST00000150636]
Predicted Effect unknown
Transcript: ENSMUST00000023745
AA Change: K808E
SMART Domains Protein: ENSMUSP00000023745
Gene: ENSMUSG00000023007
AA Change: K808E

DomainStartEndE-ValueType
low complexity region 1 24 N/A INTRINSIC
low complexity region 28 52 N/A INTRINSIC
low complexity region 56 87 N/A INTRINSIC
WW 93 125 7.6e-9 SMART
WW 134 166 1.75e-8 SMART
low complexity region 182 212 N/A INTRINSIC
low complexity region 255 267 N/A INTRINSIC
FF 276 330 2.36e-14 SMART
FF 410 470 6.94e-3 SMART
FF 490 550 1.41e0 SMART
low complexity region 557 568 N/A INTRINSIC
FF 626 682 3.41e-11 SMART
low complexity region 693 776 N/A INTRINSIC
low complexity region 777 796 N/A INTRINSIC
low complexity region 809 825 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081224
SMART Domains Protein: ENSMUSP00000079984
Gene: ENSMUSG00000023008

DomainStartEndE-ValueType
Drf_GBD 26 227 2.99e-88 SMART
Drf_FH3 230 421 6.1e-71 SMART
low complexity region 448 497 N/A INTRINSIC
FH2 510 944 9.85e-141 SMART
low complexity region 960 975 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088233
SMART Domains Protein: ENSMUSP00000085566
Gene: ENSMUSG00000023008

DomainStartEndE-ValueType
Drf_GBD 26 278 3.91e-92 SMART
Drf_FH3 281 472 6.1e-71 SMART
low complexity region 499 548 N/A INTRINSIC
FH2 561 995 9.85e-141 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000118287
AA Change: K809E

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113282
Gene: ENSMUSG00000023007
AA Change: K809E

DomainStartEndE-ValueType
low complexity region 1 24 N/A INTRINSIC
low complexity region 28 52 N/A INTRINSIC
low complexity region 56 87 N/A INTRINSIC
WW 93 125 7.6e-9 SMART
WW 134 166 1.75e-8 SMART
low complexity region 182 212 N/A INTRINSIC
low complexity region 255 267 N/A INTRINSIC
FF 276 330 2.36e-14 SMART
FF 410 470 6.94e-3 SMART
FF 490 550 1.41e0 SMART
low complexity region 557 568 N/A INTRINSIC
FF 626 682 3.41e-11 SMART
low complexity region 694 777 N/A INTRINSIC
low complexity region 778 797 N/A INTRINSIC
low complexity region 810 826 N/A INTRINSIC
low complexity region 845 866 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120633
SMART Domains Protein: ENSMUSP00000113094
Gene: ENSMUSG00000023008

DomainStartEndE-ValueType
Drf_GBD 26 278 3.91e-92 SMART
Drf_FH3 281 472 6.1e-71 SMART
low complexity region 499 548 N/A INTRINSIC
FH2 561 995 9.85e-141 SMART
low complexity region 1011 1026 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000126955
Predicted Effect
SMART Domains Protein: ENSMUSP00000120030
Gene: ENSMUSG00000023007
AA Change: K195E

DomainStartEndE-ValueType
Pfam:FF 11 62 2.2e-7 PFAM
low complexity region 77 92 N/A INTRINSIC
low complexity region 103 164 N/A INTRINSIC
low complexity region 165 184 N/A INTRINSIC
low complexity region 197 213 N/A INTRINSIC
low complexity region 232 253 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000136980
AA Change: K796E
SMART Domains Protein: ENSMUSP00000122649
Gene: ENSMUSG00000023007
AA Change: K796E

DomainStartEndE-ValueType
low complexity region 1 18 N/A INTRINSIC
low complexity region 22 46 N/A INTRINSIC
low complexity region 50 81 N/A INTRINSIC
WW 87 119 7.6e-9 SMART
WW 128 160 1.75e-8 SMART
low complexity region 176 206 N/A INTRINSIC
low complexity region 249 261 N/A INTRINSIC
FF 270 324 2.36e-14 SMART
FF 404 464 6.94e-3 SMART
FF 484 544 1.41e0 SMART
FF 613 669 3.41e-11 SMART
low complexity region 681 764 N/A INTRINSIC
low complexity region 765 784 N/A INTRINSIC
low complexity region 797 813 N/A INTRINSIC
low complexity region 832 853 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000145482
AA Change: K812E
SMART Domains Protein: ENSMUSP00000115869
Gene: ENSMUSG00000023007
AA Change: K812E

DomainStartEndE-ValueType
low complexity region 1 24 N/A INTRINSIC
low complexity region 28 52 N/A INTRINSIC
low complexity region 56 87 N/A INTRINSIC
WW 93 125 7.6e-9 SMART
WW 134 166 1.75e-8 SMART
low complexity region 182 212 N/A INTRINSIC
low complexity region 255 267 N/A INTRINSIC
FF 276 330 2.36e-14 SMART
FF 410 470 6.94e-3 SMART
FF 490 550 1.41e0 SMART
low complexity region 557 568 N/A INTRINSIC
FF 626 682 3.41e-11 SMART
low complexity region 693 708 N/A INTRINSIC
low complexity region 719 780 N/A INTRINSIC
low complexity region 781 800 N/A INTRINSIC
low complexity region 813 829 N/A INTRINSIC
low complexity region 848 869 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000150636
SMART Domains Protein: ENSMUSP00000119295
Gene: ENSMUSG00000023007

DomainStartEndE-ValueType
Pfam:FF 1 52 1.2e-7 PFAM
low complexity region 67 82 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a WW-domain containing protein similar to yeast splicing factor PRP40. This protein has been shown to interact with Huntingtin and methyl CpG binding protein 2 (MeCP2). Alternative splicing results in different transcript variants. [provided by RefSeq, Aug 2014]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930003A15Rik T C 16: 19,883,806 D24G noncoding transcript Het
Adam32 A G 8: 24,901,470 S343P possibly damaging Het
Agbl2 G A 2: 90,797,564 G238R probably damaging Het
Ahi1 T A 10: 20,972,092 D466E probably benign Het
Ahnak T A 19: 9,001,946 V198E probably damaging Het
Ank2 T A 3: 126,937,785 H658L possibly damaging Het
Atp8b5 T A 4: 43,366,072 I781N probably damaging Het
Bloc1s6 A T 2: 122,742,645 R47* probably null Het
Clk2 G A 3: 89,173,504 V266M probably damaging Het
Cul9 A C 17: 46,530,014 Y777D probably damaging Het
Dcp1a C T 14: 30,479,598 probably benign Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Dnajb2 T G 1: 75,243,582 D248E Het
Dpy19l1 T C 9: 24,502,895 H79R probably benign Het
Elmo1 T C 13: 20,600,201 S643P probably damaging Het
Evi5 A G 5: 107,818,887 probably null Het
Fam76b T C 9: 13,831,102 C110R probably damaging Het
Galnt7 T A 8: 57,538,188 K429N probably benign Het
Gm10142 T A 10: 77,716,116 C104S probably damaging Het
Gm7298 A C 6: 121,787,443 H1427P probably benign Het
Golga7b A T 19: 42,266,871 I87F probably damaging Het
Gpr165 C A X: 96,714,017 D7E probably benign Het
Gpr25 C A 1: 136,260,677 R66L probably benign Het
H2-Q2 A G 17: 35,344,865 N241D probably benign Het
Il1a T C 2: 129,302,961 D179G probably benign Het
Itch T C 2: 155,206,383 probably null Het
Itsn2 T C 12: 4,662,052 V913A probably benign Het
Kdm1b T A 13: 47,071,878 probably benign Het
Lama4 T C 10: 39,061,379 I655T possibly damaging Het
Lats1 T A 10: 7,705,903 S817R probably damaging Het
Lrrc8c A T 5: 105,607,867 M503L probably benign Het
Mast4 T C 13: 102,738,721 T1380A probably damaging Het
Mfap1a G T 2: 121,506,495 T16K possibly damaging Het
Mroh2b C T 15: 4,931,104 T773I probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nudt7 A G 8: 114,151,997 Y255C probably benign Het
Pfas T C 11: 69,000,263 T310A probably damaging Het
Pkhd1l1 T G 15: 44,543,546 I2393R probably damaging Het
Pmm1 A C 15: 81,960,731 L24R possibly damaging Het
Pram1 T C 17: 33,641,164 V235A probably benign Het
Prg4 T C 1: 150,455,126 T599A unknown Het
Qars G A 9: 108,509,452 A155T probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rgs6 A G 12: 83,137,704 probably benign Het
Rom1 T A 19: 8,928,681 R165W probably damaging Het
Rps6kb2 T A 19: 4,156,988 probably benign Het
Ryr1 A T 7: 29,069,121 W2808R probably damaging Het
Sh3gl1 A G 17: 56,019,038 probably null Het
Slc22a30 A T 19: 8,370,199 M279K probably benign Het
Snx11 A G 11: 96,769,933 S184P unknown Het
Srgap1 A G 10: 121,804,817 C692R probably damaging Het
Srgap3 T C 6: 112,723,143 N982S probably damaging Het
Stac T A 9: 111,593,745 D270V probably benign Het
Syn3 T A 10: 86,135,021 I246F probably benign Het
Tnr T C 1: 159,892,093 V980A probably damaging Het
Usp17le G T 7: 104,769,794 A47E possibly damaging Het
Vmn2r118 T C 17: 55,610,936 N192S probably benign Het
Zmym4 C A 4: 126,905,369 V725L possibly damaging Het
Other mutations in Prpf40b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00688:Prpf40b APN 15 99316131 missense probably benign 0.04
IGL00821:Prpf40b APN 15 99316501 missense probably benign 0.04
IGL00949:Prpf40b APN 15 99306538 missense probably benign 0.00
IGL01621:Prpf40b APN 15 99310045 unclassified probably benign
IGL01816:Prpf40b APN 15 99315218 missense probably damaging 1.00
IGL01878:Prpf40b APN 15 99306532 missense possibly damaging 0.84
IGL01886:Prpf40b APN 15 99304447 missense unknown
IGL02025:Prpf40b APN 15 99314588 missense probably damaging 1.00
IGL02440:Prpf40b APN 15 99306866 missense probably damaging 0.98
R0101:Prpf40b UTSW 15 99306800 splice site probably benign
R0284:Prpf40b UTSW 15 99316393 splice site probably benign
R0356:Prpf40b UTSW 15 99305199 splice site probably null
R0602:Prpf40b UTSW 15 99304471 missense unknown
R0632:Prpf40b UTSW 15 99316289 missense probably benign 0.04
R1220:Prpf40b UTSW 15 99316348 missense probably benign 0.10
R1660:Prpf40b UTSW 15 99305561 missense probably damaging 1.00
R2224:Prpf40b UTSW 15 99303291 start gained probably benign
R2245:Prpf40b UTSW 15 99305166 intron probably benign
R2342:Prpf40b UTSW 15 99306168 missense probably damaging 0.98
R4019:Prpf40b UTSW 15 99316476 missense probably benign 0.10
R4449:Prpf40b UTSW 15 99314663 missense probably damaging 1.00
R4622:Prpf40b UTSW 15 99316316 missense probably benign 0.01
R4869:Prpf40b UTSW 15 99309845 intron probably benign
R5960:Prpf40b UTSW 15 99314904 missense probably damaging 1.00
R6734:Prpf40b UTSW 15 99314903 missense probably damaging 1.00
R6735:Prpf40b UTSW 15 99314903 missense probably damaging 1.00
R6776:Prpf40b UTSW 15 99314903 missense probably damaging 1.00
R6783:Prpf40b UTSW 15 99314903 missense probably damaging 1.00
R7025:Prpf40b UTSW 15 99306400 nonsense probably null
R7544:Prpf40b UTSW 15 99306018 missense probably benign 0.01
R7733:Prpf40b UTSW 15 99308343 critical splice donor site probably null
R8133:Prpf40b UTSW 15 99304438 missense unknown
R8193:Prpf40b UTSW 15 99304068 missense unknown
X0019:Prpf40b UTSW 15 99307703 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGACTTCCTATCTCTGCCCAG -3'
(R):5'- TCTGTTGAGCAAAGGTGTGAC -3'

Sequencing Primer
(F):5'- AACCCTATAGATCATGGTCTTCGG -3'
(R):5'- TTGAGCAAAGGTGTGACTTACC -3'
Posted On2020-07-28