Incidental Mutation 'R0095:Anxa8'
ID64040
Institutional Source Beutler Lab
Gene Symbol Anxa8
Ensembl Gene ENSMUSG00000021950
Gene Nameannexin A8
SynonymsAnx8
MMRRC Submission 038381-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0095 (G1)
Quality Score94
Status Not validated
Chromosome14
Chromosomal Location34085981-34100571 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 34086071 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 6 (A6T)
Ref Sequence ENSEMBL: ENSMUSP00000113662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022519] [ENSMUST00000120077] [ENSMUST00000178958]
Predicted Effect probably benign
Transcript: ENSMUST00000022519
AA Change: A6T

PolyPhen 2 Score 0.187 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000022519
Gene: ENSMUSG00000021950
AA Change: A6T

DomainStartEndE-ValueType
ANX 38 90 6.69e-25 SMART
ANX 110 162 5.57e-22 SMART
ANX 195 247 1.12e-17 SMART
ANX 270 322 9.26e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120077
AA Change: A6T

PolyPhen 2 Score 0.187 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000113662
Gene: ENSMUSG00000021950
AA Change: A6T

DomainStartEndE-ValueType
ANX 38 90 6.69e-25 SMART
ANX 110 162 5.57e-22 SMART
ANX 165 221 4.14e-1 SMART
ANX 244 296 9.26e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178958
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215823
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227780
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a floxed allele activated in all cells exhibit impaired leukocyte rolling flux and adhesion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bicc1 T A 10: 70,961,158 I42F probably damaging Het
Cutc T C 19: 43,753,199 W13R probably benign Het
F5 A T 1: 164,191,968 R671* probably null Het
Fam84b T C 15: 60,823,576 Y107C probably damaging Het
Fer A T 17: 63,941,326 E361V possibly damaging Het
Hnrnpa3 G T 2: 75,661,696 R52L probably damaging Het
Igsf10 A T 3: 59,331,196 Y521* probably null Het
Mmp1a G A 9: 7,465,620 G186D possibly damaging Het
Naip1 T C 13: 100,423,083 T1138A probably benign Het
Necab1 T A 4: 14,960,027 N307Y possibly damaging Het
Olfr510 A C 7: 108,668,045 I210L probably benign Het
Plekha5 T C 6: 140,528,597 F84L probably damaging Het
Rpl6 T G 5: 121,205,839 V115G possibly damaging Het
Sec16a A T 2: 26,425,760 probably null Het
Tpsg1 T C 17: 25,372,554 W43R probably damaging Het
Unc45a T C 7: 80,329,543 D567G probably damaging Het
Usp30 T A 5: 114,105,840 F157I probably damaging Het
Zfp345 T A 2: 150,472,300 H439L probably damaging Het
Other mutations in Anxa8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01300:Anxa8 APN 14 34099743 missense probably benign 0.33
IGL01335:Anxa8 APN 14 34089590 missense probably damaging 1.00
IGL02131:Anxa8 APN 14 34090631 missense possibly damaging 0.90
IGL02675:Anxa8 APN 14 34093414 missense probably damaging 0.98
IGL02887:Anxa8 APN 14 34096524 splice site probably null
R0095:Anxa8 UTSW 14 34086071 missense probably benign 0.19
R0138:Anxa8 UTSW 14 34097939 missense probably benign 0.01
R0138:Anxa8 UTSW 14 34097940 missense possibly damaging 0.54
R0452:Anxa8 UTSW 14 34094770 missense probably damaging 1.00
R1586:Anxa8 UTSW 14 34093937 missense probably damaging 1.00
R1727:Anxa8 UTSW 14 34089590 missense probably damaging 1.00
R1982:Anxa8 UTSW 14 34096570 missense probably damaging 1.00
R2141:Anxa8 UTSW 14 34091916 critical splice donor site probably null
R3921:Anxa8 UTSW 14 34094446 missense probably damaging 1.00
R4803:Anxa8 UTSW 14 34092622 critical splice donor site probably null
R5372:Anxa8 UTSW 14 34093911 missense probably damaging 1.00
R6349:Anxa8 UTSW 14 34097893 missense probably damaging 0.98
R6823:Anxa8 UTSW 14 34094765 missense possibly damaging 0.88
R6837:Anxa8 UTSW 14 34092554 missense probably damaging 1.00
R8079:Anxa8 UTSW 14 34094812 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGCTATGTGACAGCCACAGCC -3'
(R):5'- AGTCTCCCTCTGGACACTCGAATC -3'

Sequencing Primer
(F):5'- AACATTCTCAGGGCAGGC -3'
(R):5'- TGGACACTCGAATCCTTTAGC -3'
Posted On2013-08-06