Mutagenetix > Incidental Mutation

Incidental Mutation 'R8248:Vmn2r118'

640403

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r118

Ensembl Gene

ENSMUSG00000091504

Gene Name

vomeronasal 2, receptor 118

Synonyms

EG383258, Vmn2r119, EG668547

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.137) question?

Stock #

R8248 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

55592341-55624672 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 55610936 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 192 (N192S)

Ref Sequence

ENSEMBL: ENSMUSP00000131128 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168440]

AlphaFold

E9Q1C1

Predicted Effect

probably benign
Transcript: ENSMUST00000168440
AA Change: N192S

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000131128
Gene: ENSMUSG00000091504
AA Change: N192S

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:ANF_receptor	142	470	4.6e-27	PFAM
Pfam:NCD3G	513	566	2.6e-20	PFAM
Pfam:7tm_3	599	834	5.9e-55	PFAM

Meta Mutation Damage Score

0.0846

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (60/60)

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A930003A15Rik	T	C	16: 19,883,806	D24G	noncoding transcript	Het
Adam32	A	G	8: 24,901,470	S343P	possibly damaging	Het
Agbl2	G	A	2: 90,797,564	G238R	probably damaging	Het
Ahi1	T	A	10: 20,972,092	D466E	probably benign	Het
Ahnak	T	A	19: 9,001,946	V198E	probably damaging	Het
Ank2	T	A	3: 126,937,785	H658L	possibly damaging	Het
Atp8b5	T	A	4: 43,366,072	I781N	probably damaging	Het
Bloc1s6	A	T	2: 122,742,645	R47*	probably null	Het
Clk2	G	A	3: 89,173,504	V266M	probably damaging	Het
Cul9	A	C	17: 46,530,014	Y777D	probably damaging	Het
Dcp1a	C	T	14: 30,479,598		probably benign	Het
Dcp1a	A	G	14: 30,522,926	T570A	possibly damaging	Het
Dnajb2	T	G	1: 75,243,582	D248E		Het
Dpy19l1	T	C	9: 24,502,895	H79R	probably benign	Het
Elmo1	T	C	13: 20,600,201	S643P	probably damaging	Het
Evi5	A	G	5: 107,818,887		probably null	Het
Fam76b	T	C	9: 13,831,102	C110R	probably damaging	Het
Galnt7	T	A	8: 57,538,188	K429N	probably benign	Het
Gm10142	T	A	10: 77,716,116	C104S	probably damaging	Het
Gm7298	A	C	6: 121,787,443	H1427P	probably benign	Het
Golga7b	A	T	19: 42,266,871	I87F	probably damaging	Het
Gpr165	C	A	X: 96,714,017	D7E	probably benign	Het
Gpr25	C	A	1: 136,260,677	R66L	probably benign	Het
H2-Q2	A	G	17: 35,344,865	N241D	probably benign	Het
Il1a	T	C	2: 129,302,961	D179G	probably benign	Het
Itch	T	C	2: 155,206,383		probably null	Het
Itsn2	T	C	12: 4,662,052	V913A	probably benign	Het
Kdm1b	T	A	13: 47,071,878		probably benign	Het
Lama4	T	C	10: 39,061,379	I655T	possibly damaging	Het
Lats1	T	A	10: 7,705,903	S817R	probably damaging	Het
Lrrc8c	A	T	5: 105,607,867	M503L	probably benign	Het
Mast4	T	C	13: 102,738,721	T1380A	probably damaging	Het
Mfap1a	G	T	2: 121,506,495	T16K	possibly damaging	Het
Mroh2b	C	T	15: 4,931,104	T773I	probably benign	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Nudt7	A	G	8: 114,151,997	Y255C	probably benign	Het
Pfas	T	C	11: 69,000,263	T310A	probably damaging	Het
Pkhd1l1	T	G	15: 44,543,546	I2393R	probably damaging	Het
Pmm1	A	C	15: 81,960,731	L24R	possibly damaging	Het
Pram1	T	C	17: 33,641,164	V235A	probably benign	Het
Prg4	T	C	1: 150,455,126	T599A	unknown	Het
Prpf40b	A	G	15: 99,316,285	K812E	unknown	Het
Qars	G	A	9: 108,509,452	A155T	probably benign	Het
Rftn1	G	T	17: 50,047,380	A318D	probably damaging	Het
Rgs6	A	G	12: 83,137,704		probably benign	Het
Rom1	T	A	19: 8,928,681	R165W	probably damaging	Het
Rps6kb2	T	A	19: 4,156,988		probably benign	Het
Ryr1	A	T	7: 29,069,121	W2808R	probably damaging	Het
Sh3gl1	A	G	17: 56,019,038		probably null	Het
Slc22a30	A	T	19: 8,370,199	M279K	probably benign	Het
Snx11	A	G	11: 96,769,933	S184P	unknown	Het
Srgap1	A	G	10: 121,804,817	C692R	probably damaging	Het
Srgap3	T	C	6: 112,723,143	N982S	probably damaging	Het
Stac	T	A	9: 111,593,745	D270V	probably benign	Het
Syn3	T	A	10: 86,135,021	I246F	probably benign	Het
Tnr	T	C	1: 159,892,093	V980A	probably damaging	Het
Usp17le	G	T	7: 104,769,794	A47E	possibly damaging	Het
Zmym4	C	A	4: 126,905,369	V725L	possibly damaging	Het

Other mutations in Vmn2r118

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Vmn2r118	APN	17	55592708	missense	probably damaging	1.00
IGL00976:Vmn2r118	APN	17	55593204	missense	probably damaging	1.00
IGL01419:Vmn2r118	APN	17	55593000	missense	probably benign	0.01
IGL01796:Vmn2r118	APN	17	55608585	missense	probably benign	0.30
IGL01799:Vmn2r118	APN	17	55592990	missense	probably damaging	1.00
IGL02002:Vmn2r118	APN	17	55592619	missense	probably damaging	1.00
IGL02075:Vmn2r118	APN	17	55610517	missense	probably benign	0.18
IGL02172:Vmn2r118	APN	17	55624598	missense	probably benign	0.00
IGL02529:Vmn2r118	APN	17	55610870	missense	possibly damaging	0.58
IGL02712:Vmn2r118	APN	17	55592655	missense	probably benign	0.21
IGL03096:Vmn2r118	APN	17	55607996	missense	probably damaging	1.00
R0306:Vmn2r118	UTSW	17	55608616	missense	possibly damaging	0.89
R0329:Vmn2r118	UTSW	17	55610717	missense	probably damaging	1.00
R0330:Vmn2r118	UTSW	17	55610717	missense	probably damaging	1.00
R0396:Vmn2r118	UTSW	17	55608643	missense	probably benign	0.00
R0411:Vmn2r118	UTSW	17	55611021	splice site	probably benign
R0513:Vmn2r118	UTSW	17	55610970	nonsense	probably null
R0627:Vmn2r118	UTSW	17	55610772	missense	probably benign	0.01
R0638:Vmn2r118	UTSW	17	55608466	missense	probably benign	0.03
R1328:Vmn2r118	UTSW	17	55608620	missense	probably benign	0.01
R1366:Vmn2r118	UTSW	17	55593237	nonsense	probably null
R1465:Vmn2r118	UTSW	17	55610935	missense	probably benign	0.33
R1465:Vmn2r118	UTSW	17	55610935	missense	probably benign	0.33
R1511:Vmn2r118	UTSW	17	55608496	nonsense	probably null
R1515:Vmn2r118	UTSW	17	55610643	missense	probably benign	0.25
R1550:Vmn2r118	UTSW	17	55608083	missense	probably damaging	1.00
R1779:Vmn2r118	UTSW	17	55611530	missense	probably benign	0.03
R1834:Vmn2r118	UTSW	17	55592456	missense	probably damaging	1.00
R1840:Vmn2r118	UTSW	17	55610406	nonsense	probably null
R1854:Vmn2r118	UTSW	17	55611556	missense	possibly damaging	0.57
R1967:Vmn2r118	UTSW	17	55592882	missense	probably damaging	1.00
R1976:Vmn2r118	UTSW	17	55592925	missense	probably damaging	1.00
R2308:Vmn2r118	UTSW	17	55624650	missense	probably benign	0.33
R3700:Vmn2r118	UTSW	17	55608421	missense	possibly damaging	0.68
R4334:Vmn2r118	UTSW	17	55610347	missense	possibly damaging	0.58
R4647:Vmn2r118	UTSW	17	55610665	missense	probably damaging	1.00
R4709:Vmn2r118	UTSW	17	55610860	missense	probably damaging	1.00
R4805:Vmn2r118	UTSW	17	55592581	missense	probably damaging	1.00
R4858:Vmn2r118	UTSW	17	55592894	missense	probably damaging	0.98
R5384:Vmn2r118	UTSW	17	55611565	missense	probably benign	0.00
R5385:Vmn2r118	UTSW	17	55611565	missense	probably benign	0.00
R5664:Vmn2r118	UTSW	17	55592765	missense	possibly damaging	0.46
R5740:Vmn2r118	UTSW	17	55593103	missense	probably benign	0.00
R5927:Vmn2r118	UTSW	17	55624494	missense	probably benign	0.04
R6143:Vmn2r118	UTSW	17	55592871	missense	possibly damaging	0.92
R6513:Vmn2r118	UTSW	17	55608093	missense	probably damaging	1.00
R6573:Vmn2r118	UTSW	17	55592996	missense	probably damaging	1.00
R6760:Vmn2r118	UTSW	17	55592714	missense	possibly damaging	0.92
R6794:Vmn2r118	UTSW	17	55592348	missense	possibly damaging	0.48
R6929:Vmn2r118	UTSW	17	55610440	missense	probably benign	0.01
R7201:Vmn2r118	UTSW	17	55608496	nonsense	probably null
R7539:Vmn2r118	UTSW	17	55592853	missense	probably damaging	0.98
R7836:Vmn2r118	UTSW	17	55593242	missense	probably damaging	0.99
R8179:Vmn2r118	UTSW	17	55608484	missense	probably benign	0.36
R8347:Vmn2r118	UTSW	17	55610423	missense	possibly damaging	0.94
R8415:Vmn2r118	UTSW	17	55608057	missense	probably benign	0.08
R8428:Vmn2r118	UTSW	17	55608642	missense	probably benign	0.33
R8917:Vmn2r118	UTSW	17	55610216	missense	possibly damaging	0.82
R8993:Vmn2r118	UTSW	17	55610835	missense	possibly damaging	0.72
R9038:Vmn2r118	UTSW	17	55611649	missense	probably damaging	1.00
R9155:Vmn2r118	UTSW	17	55610207	missense	probably null	0.83
R9603:Vmn2r118	UTSW	17	55592837	missense	probably damaging	1.00
R9742:Vmn2r118	UTSW	17	55611009	missense	probably damaging	0.98
R9749:Vmn2r118	UTSW	17	55608415	critical splice donor site	probably null
R9792:Vmn2r118	UTSW	17	55592496	missense	probably damaging	0.99
R9793:Vmn2r118	UTSW	17	55592496	missense	probably damaging	0.99
R9795:Vmn2r118	UTSW	17	55592496	missense	probably damaging	0.99
X0022:Vmn2r118	UTSW	17	55593218	missense	probably damaging	1.00
Z1176:Vmn2r118	UTSW	17	55610655	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AATGCATGTTCTGTGGAATCAC -3'
(R):5'- TACATTTCCAGAGGATTATGGGTAG -3'

Sequencing Primer
(F):5'- GTGGAATCACATTCACAAAGGC -3'
(R):5'- TCCAGAGGATTATGGGTAGTTAAG -3'

Posted On

2020-07-28