Incidental Mutation 'R8248:Sh3gl1'
ID640404
Institutional Source Beutler Lab
Gene Symbol Sh3gl1
Ensembl Gene ENSMUSG00000003200
Gene NameSH3-domain GRB2-like 1
SynonymsSh3d2b, SH3P8, endophilin II, EEN
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8248 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location56016753-56036637 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 56019038 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000003268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003268] [ENSMUST00000149441] [ENSMUST00000159996] [ENSMUST00000162883]
Predicted Effect probably null
Transcript: ENSMUST00000003268
SMART Domains Protein: ENSMUSP00000003268
Gene: ENSMUSG00000003200

DomainStartEndE-ValueType
BAR 5 242 1.05e-98 SMART
low complexity region 250 264 N/A INTRINSIC
SH3 309 364 7.62e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149441
SMART Domains Protein: ENSMUSP00000119745
Gene: ENSMUSG00000003199

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
low complexity region 32 71 N/A INTRINSIC
low complexity region 172 185 N/A INTRINSIC
JAB_MPN 260 382 1.35e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153197
SMART Domains Protein: ENSMUSP00000125535
Gene: ENSMUSG00000003199

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
Pfam:JAB 112 243 6.1e-11 PFAM
Pfam:Prok-JAB 125 258 1.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159340
SMART Domains Protein: ENSMUSP00000125555
Gene: ENSMUSG00000003199

DomainStartEndE-ValueType
low complexity region 10 27 N/A INTRINSIC
low complexity region 29 68 N/A INTRINSIC
low complexity region 169 182 N/A INTRINSIC
Blast:JAB_MPN 257 350 3e-55 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000159996
SMART Domains Protein: ENSMUSP00000124644
Gene: ENSMUSG00000003199

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
low complexity region 32 71 N/A INTRINSIC
low complexity region 172 185 N/A INTRINSIC
JAB_MPN 260 382 1.35e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162883
SMART Domains Protein: ENSMUSP00000124128
Gene: ENSMUSG00000003199

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
low complexity region 32 71 N/A INTRINSIC
low complexity region 172 185 N/A INTRINSIC
Pfam:Prok-JAB 230 340 1.6e-8 PFAM
Pfam:JAB 236 311 1.7e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the endophilin family of Src homology 3 domain-containing proteins. The encoded protein is involved in endocytosis and may also play a role in the cell cycle. Overexpression of this gene may play a role in leukemogenesis, and the encoded protein has been implicated in acute myeloid leukemia as a fusion partner of the myeloid-lymphoid leukemia protein. Pseudogenes of this gene are located on the long arm of chromosomes 11 and 17. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal life span and no obvious phenotypic defects. Mice homozygous for knock-out alleles of Sh3gl1-3 exhibit neonatal lethality, respiratory distress, absence of gastric milk, abnormal synaptic transmissionand abnormal synaptic vesicle recycling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930003A15Rik T C 16: 19,883,806 D24G noncoding transcript Het
Adam32 A G 8: 24,901,470 S343P possibly damaging Het
Agbl2 G A 2: 90,797,564 G238R probably damaging Het
Ahi1 T A 10: 20,972,092 D466E probably benign Het
Ahnak T A 19: 9,001,946 V198E probably damaging Het
Ank2 T A 3: 126,937,785 H658L possibly damaging Het
Atp8b5 T A 4: 43,366,072 I781N probably damaging Het
Bloc1s6 A T 2: 122,742,645 R47* probably null Het
Clk2 G A 3: 89,173,504 V266M probably damaging Het
Cul9 A C 17: 46,530,014 Y777D probably damaging Het
Dcp1a C T 14: 30,479,598 probably benign Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Dnajb2 T G 1: 75,243,582 D248E Het
Dpy19l1 T C 9: 24,502,895 H79R probably benign Het
Elmo1 T C 13: 20,600,201 S643P probably damaging Het
Evi5 A G 5: 107,818,887 probably null Het
Fam76b T C 9: 13,831,102 C110R probably damaging Het
Galnt7 T A 8: 57,538,188 K429N probably benign Het
Gm10142 T A 10: 77,716,116 C104S probably damaging Het
Gm7298 A C 6: 121,787,443 H1427P probably benign Het
Golga7b A T 19: 42,266,871 I87F probably damaging Het
Gpr165 C A X: 96,714,017 D7E probably benign Het
Gpr25 C A 1: 136,260,677 R66L probably benign Het
H2-Q2 A G 17: 35,344,865 N241D probably benign Het
Il1a T C 2: 129,302,961 D179G probably benign Het
Itch T C 2: 155,206,383 probably null Het
Itsn2 T C 12: 4,662,052 V913A probably benign Het
Kdm1b T A 13: 47,071,878 probably benign Het
Lama4 T C 10: 39,061,379 I655T possibly damaging Het
Lats1 T A 10: 7,705,903 S817R probably damaging Het
Lrrc8c A T 5: 105,607,867 M503L probably benign Het
Mast4 T C 13: 102,738,721 T1380A probably damaging Het
Mfap1a G T 2: 121,506,495 T16K possibly damaging Het
Mroh2b C T 15: 4,931,104 T773I probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nudt7 A G 8: 114,151,997 Y255C probably benign Het
Pfas T C 11: 69,000,263 T310A probably damaging Het
Pkhd1l1 T G 15: 44,543,546 I2393R probably damaging Het
Pmm1 A C 15: 81,960,731 L24R possibly damaging Het
Pram1 T C 17: 33,641,164 V235A probably benign Het
Prg4 T C 1: 150,455,126 T599A unknown Het
Prpf40b A G 15: 99,316,285 K812E unknown Het
Qars G A 9: 108,509,452 A155T probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rgs6 A G 12: 83,137,704 probably benign Het
Rom1 T A 19: 8,928,681 R165W probably damaging Het
Rps6kb2 T A 19: 4,156,988 probably benign Het
Ryr1 A T 7: 29,069,121 W2808R probably damaging Het
Slc22a30 A T 19: 8,370,199 M279K probably benign Het
Snx11 A G 11: 96,769,933 S184P unknown Het
Srgap1 A G 10: 121,804,817 C692R probably damaging Het
Srgap3 T C 6: 112,723,143 N982S probably damaging Het
Stac T A 9: 111,593,745 D270V probably benign Het
Syn3 T A 10: 86,135,021 I246F probably benign Het
Tnr T C 1: 159,892,093 V980A probably damaging Het
Usp17le G T 7: 104,769,794 A47E possibly damaging Het
Vmn2r118 T C 17: 55,610,936 N192S probably benign Het
Zmym4 C A 4: 126,905,369 V725L possibly damaging Het
Other mutations in Sh3gl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01784:Sh3gl1 APN 17 56019325 missense possibly damaging 0.48
IGL02721:Sh3gl1 APN 17 56017577 missense possibly damaging 0.91
R0092:Sh3gl1 UTSW 17 56018088 missense probably benign 0.00
R0525:Sh3gl1 UTSW 17 56017873 missense probably benign 0.00
R3684:Sh3gl1 UTSW 17 56018953 missense possibly damaging 0.91
R3792:Sh3gl1 UTSW 17 56018949 missense probably damaging 1.00
R4282:Sh3gl1 UTSW 17 56036456 missense probably damaging 1.00
R4298:Sh3gl1 UTSW 17 56019173 missense probably damaging 1.00
R5868:Sh3gl1 UTSW 17 56019119 missense probably damaging 1.00
R6304:Sh3gl1 UTSW 17 56036431 missense probably benign 0.01
R6379:Sh3gl1 UTSW 17 56019143 missense probably damaging 1.00
R6523:Sh3gl1 UTSW 17 56017617 missense possibly damaging 0.84
R7146:Sh3gl1 UTSW 17 56017646 missense probably damaging 1.00
R7174:Sh3gl1 UTSW 17 56017846 missense probably benign 0.01
R7922:Sh3gl1 UTSW 17 56019438 missense probably damaging 1.00
R8429:Sh3gl1 UTSW 17 56018821 missense possibly damaging 0.94
R8460:Sh3gl1 UTSW 17 56019321 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TCTCCAGGAGGTTGTGCATAC -3'
(R):5'- GGAAGTCCTACCCATGACAG -3'

Sequencing Primer
(F):5'- GGACTCCTCGAACTTCTCTAGGG -3'
(R):5'- ATGACAGTCACCCCTCCCTG -3'
Posted On2020-07-28