Incidental Mutation 'R8248:Slc22a30'
ID 640405
Institutional Source Beutler Lab
Gene Symbol Slc22a30
Ensembl Gene ENSMUSG00000052562
Gene Name solute carrier family 22, member 30
Synonyms C730048C13Rik
MMRRC Submission 067675-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.067) question?
Stock # R8248 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 8312735-8382475 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 8347563 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 279 (M279K)
Ref Sequence ENSEMBL: ENSMUSP00000093988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064507] [ENSMUST00000096269] [ENSMUST00000120540]
AlphaFold Q96LX3
Predicted Effect probably benign
Transcript: ENSMUST00000064507
AA Change: M279K

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000069461
Gene: ENSMUSG00000052562
AA Change: M279K

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Sugar_tr 99 439 3.1e-21 PFAM
Pfam:MFS_1 127 433 8.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000096269
AA Change: M279K

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000093988
Gene: ENSMUSG00000052562
AA Change: M279K

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Sugar_tr 99 527 9.6e-27 PFAM
Pfam:MFS_1 140 376 1.2e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120540
AA Change: M279K

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000114071
Gene: ENSMUSG00000052562
AA Change: M279K

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Sugar_tr 99 435 1.3e-20 PFAM
Pfam:MFS_1 127 435 1.5e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930003A15Rik T C 16: 19,702,556 (GRCm39) D24G noncoding transcript Het
Adam32 A G 8: 25,391,486 (GRCm39) S343P possibly damaging Het
Agbl2 G A 2: 90,627,908 (GRCm39) G238R probably damaging Het
Ahi1 T A 10: 20,847,991 (GRCm39) D466E probably benign Het
Ahnak T A 19: 8,979,310 (GRCm39) V198E probably damaging Het
Ank2 T A 3: 126,731,434 (GRCm39) H658L possibly damaging Het
Atp8b5 T A 4: 43,366,072 (GRCm39) I781N probably damaging Het
Bloc1s6 A T 2: 122,584,565 (GRCm39) R47* probably null Het
Clk2 G A 3: 89,080,811 (GRCm39) V266M probably damaging Het
Cul9 A C 17: 46,840,940 (GRCm39) Y777D probably damaging Het
Dcp1a A G 14: 30,244,883 (GRCm39) T570A possibly damaging Het
Dcp1a C T 14: 30,201,555 (GRCm39) probably benign Het
Dnajb2 T G 1: 75,220,226 (GRCm39) D248E Het
Dpy19l1 T C 9: 24,414,191 (GRCm39) H79R probably benign Het
Elmo1 T C 13: 20,784,371 (GRCm39) S643P probably damaging Het
Evi5 A G 5: 107,966,753 (GRCm39) probably null Het
Fam76b T C 9: 13,742,398 (GRCm39) C110R probably damaging Het
Galnt7 T A 8: 57,991,222 (GRCm39) K429N probably benign Het
Gm10142 T A 10: 77,551,950 (GRCm39) C104S probably damaging Het
Gm7298 A C 6: 121,764,402 (GRCm39) H1427P probably benign Het
Golga7b A T 19: 42,255,310 (GRCm39) I87F probably damaging Het
Gpr165 C A X: 95,757,623 (GRCm39) D7E probably benign Het
Gpr25 C A 1: 136,188,415 (GRCm39) R66L probably benign Het
H2-Q2 A G 17: 35,563,841 (GRCm39) N241D probably benign Het
Il1a T C 2: 129,144,881 (GRCm39) D179G probably benign Het
Itch T C 2: 155,048,303 (GRCm39) probably null Het
Itsn2 T C 12: 4,712,052 (GRCm39) V913A probably benign Het
Kdm1b T A 13: 47,225,354 (GRCm39) probably benign Het
Lama4 T C 10: 38,937,375 (GRCm39) I655T possibly damaging Het
Lats1 T A 10: 7,581,667 (GRCm39) S817R probably damaging Het
Lrrc8c A T 5: 105,755,733 (GRCm39) M503L probably benign Het
Mast4 T C 13: 102,875,229 (GRCm39) T1380A probably damaging Het
Mfap1a G T 2: 121,336,976 (GRCm39) T16K possibly damaging Het
Mroh2b C T 15: 4,960,586 (GRCm39) T773I probably benign Het
Myl10 G C 5: 136,726,825 (GRCm39) V70L probably benign Het
Nudt7 A G 8: 114,878,737 (GRCm39) Y255C probably benign Het
Pfas T C 11: 68,891,089 (GRCm39) T310A probably damaging Het
Pkhd1l1 T G 15: 44,406,942 (GRCm39) I2393R probably damaging Het
Pmm1 A C 15: 81,844,932 (GRCm39) L24R possibly damaging Het
Pram1 T C 17: 33,860,138 (GRCm39) V235A probably benign Het
Prg4 T C 1: 150,330,877 (GRCm39) T599A unknown Het
Prpf40b A G 15: 99,214,166 (GRCm39) K812E unknown Het
Qars1 G A 9: 108,386,651 (GRCm39) A155T probably benign Het
Rftn1 G T 17: 50,354,408 (GRCm39) A318D probably damaging Het
Rgs6 A G 12: 83,184,478 (GRCm39) probably benign Het
Rom1 T A 19: 8,906,045 (GRCm39) R165W probably damaging Het
Rps6kb2 T A 19: 4,206,987 (GRCm39) probably benign Het
Ryr1 A T 7: 28,768,546 (GRCm39) W2808R probably damaging Het
Sh3gl1 A G 17: 56,326,038 (GRCm39) probably null Het
Snx11 A G 11: 96,660,759 (GRCm39) S184P unknown Het
Srgap1 A G 10: 121,640,722 (GRCm39) C692R probably damaging Het
Srgap3 T C 6: 112,700,104 (GRCm39) N982S probably damaging Het
Stac T A 9: 111,422,813 (GRCm39) D270V probably benign Het
Syn3 T A 10: 85,970,885 (GRCm39) I246F probably benign Het
Tnr T C 1: 159,719,663 (GRCm39) V980A probably damaging Het
Usp17le G T 7: 104,419,001 (GRCm39) A47E possibly damaging Het
Vmn2r118 T C 17: 55,917,936 (GRCm39) N192S probably benign Het
Zmym4 C A 4: 126,799,162 (GRCm39) V725L possibly damaging Het
Other mutations in Slc22a30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Slc22a30 APN 19 8,313,152 (GRCm39) missense probably benign 0.29
IGL01894:Slc22a30 APN 19 8,364,021 (GRCm39) missense probably benign 0.28
IGL02795:Slc22a30 APN 19 8,378,259 (GRCm39) missense probably damaging 1.00
IGL02798:Slc22a30 APN 19 8,347,449 (GRCm39) missense probably damaging 0.96
IGL03267:Slc22a30 APN 19 8,315,322 (GRCm39) missense probably benign 0.00
R0089:Slc22a30 UTSW 19 8,347,561 (GRCm39) missense probably benign 0.03
R0243:Slc22a30 UTSW 19 8,322,721 (GRCm39) missense probably benign 0.01
R1033:Slc22a30 UTSW 19 8,313,165 (GRCm39) nonsense probably null
R1781:Slc22a30 UTSW 19 8,313,136 (GRCm39) missense probably damaging 1.00
R2098:Slc22a30 UTSW 19 8,378,175 (GRCm39) missense probably damaging 1.00
R3874:Slc22a30 UTSW 19 8,314,213 (GRCm39) missense probably benign 0.31
R4091:Slc22a30 UTSW 19 8,381,909 (GRCm39) missense probably damaging 1.00
R4799:Slc22a30 UTSW 19 8,321,768 (GRCm39) missense probably benign
R5108:Slc22a30 UTSW 19 8,363,790 (GRCm39) missense probably damaging 1.00
R5191:Slc22a30 UTSW 19 8,321,757 (GRCm39) nonsense probably null
R5192:Slc22a30 UTSW 19 8,321,757 (GRCm39) nonsense probably null
R5193:Slc22a30 UTSW 19 8,321,757 (GRCm39) nonsense probably null
R5195:Slc22a30 UTSW 19 8,321,757 (GRCm39) nonsense probably null
R5253:Slc22a30 UTSW 19 8,321,757 (GRCm39) nonsense probably null
R5254:Slc22a30 UTSW 19 8,321,757 (GRCm39) nonsense probably null
R5255:Slc22a30 UTSW 19 8,321,757 (GRCm39) nonsense probably null
R5256:Slc22a30 UTSW 19 8,321,757 (GRCm39) nonsense probably null
R5377:Slc22a30 UTSW 19 8,321,757 (GRCm39) nonsense probably null
R5378:Slc22a30 UTSW 19 8,321,757 (GRCm39) nonsense probably null
R5400:Slc22a30 UTSW 19 8,321,757 (GRCm39) nonsense probably null
R5401:Slc22a30 UTSW 19 8,321,757 (GRCm39) nonsense probably null
R5481:Slc22a30 UTSW 19 8,314,201 (GRCm39) missense probably benign 0.01
R5644:Slc22a30 UTSW 19 8,381,980 (GRCm39) missense possibly damaging 0.72
R5679:Slc22a30 UTSW 19 8,313,135 (GRCm39) missense possibly damaging 0.90
R5699:Slc22a30 UTSW 19 8,321,757 (GRCm39) nonsense probably null
R5704:Slc22a30 UTSW 19 8,321,757 (GRCm39) nonsense probably null
R5706:Slc22a30 UTSW 19 8,321,757 (GRCm39) nonsense probably null
R5767:Slc22a30 UTSW 19 8,321,757 (GRCm39) nonsense probably null
R5770:Slc22a30 UTSW 19 8,363,891 (GRCm39) missense probably damaging 0.99
R5784:Slc22a30 UTSW 19 8,321,757 (GRCm39) nonsense probably null
R5793:Slc22a30 UTSW 19 8,314,183 (GRCm39) missense possibly damaging 0.95
R5813:Slc22a30 UTSW 19 8,381,945 (GRCm39) missense probably benign 0.07
R6101:Slc22a30 UTSW 19 8,315,232 (GRCm39) splice site probably null
R6105:Slc22a30 UTSW 19 8,315,232 (GRCm39) splice site probably null
R6327:Slc22a30 UTSW 19 8,313,086 (GRCm39) utr 3 prime probably benign
R6958:Slc22a30 UTSW 19 8,364,065 (GRCm39) missense probably damaging 0.98
R7162:Slc22a30 UTSW 19 8,314,081 (GRCm39) splice site probably null
R7375:Slc22a30 UTSW 19 8,382,055 (GRCm39) missense probably damaging 1.00
R7572:Slc22a30 UTSW 19 8,313,072 (GRCm39) missense unknown
R7755:Slc22a30 UTSW 19 8,314,133 (GRCm39) missense probably damaging 1.00
R8114:Slc22a30 UTSW 19 8,381,904 (GRCm39) nonsense probably null
R8677:Slc22a30 UTSW 19 8,364,035 (GRCm39) missense probably benign 0.21
R8854:Slc22a30 UTSW 19 8,363,754 (GRCm39) critical splice donor site probably null
R8900:Slc22a30 UTSW 19 8,315,340 (GRCm39) missense probably damaging 1.00
R9185:Slc22a30 UTSW 19 8,321,917 (GRCm39) missense probably benign 0.03
R9296:Slc22a30 UTSW 19 8,364,119 (GRCm39) missense probably benign 0.06
R9463:Slc22a30 UTSW 19 8,378,259 (GRCm39) missense probably damaging 1.00
R9773:Slc22a30 UTSW 19 8,321,754 (GRCm39) missense probably benign 0.01
Z1088:Slc22a30 UTSW 19 8,313,139 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATCTTGGGCACTAACTCATAC -3'
(R):5'- TATGCATTTCAGAAGTGCAGTGC -3'

Sequencing Primer
(F):5'- CTTGGGCACTAACTCATACACATGTG -3'
(R):5'- CAGTGCATTATGTGGCTGAATCATTC -3'
Posted On 2020-07-28