Mutagenetix > Incidental Mutation

Incidental Mutation 'R8248:Slc22a30'

640405

Institutional Source

Beutler Lab

Gene Symbol

Slc22a30

Ensembl Gene

ENSMUSG00000052562

Gene Name

solute carrier family 22, member 30

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.066) question?

Stock #

R8248 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

8335371-8405111 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 8370199 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 279 (M279K)

Ref Sequence

ENSEMBL: ENSMUSP00000093988 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064507] [ENSMUST00000096269] [ENSMUST00000120540]

AlphaFold

Q96LX3

Predicted Effect

probably benign
Transcript: ENSMUST00000064507
AA Change: M279K

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000069461
Gene: ENSMUSG00000052562
AA Change: M279K

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
Pfam:Sugar_tr	99	439	3.1e-21	PFAM
Pfam:MFS_1	127	433	8.8e-20	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000096269
AA Change: M279K

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000093988
Gene: ENSMUSG00000052562
AA Change: M279K

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
Pfam:Sugar_tr	99	527	9.6e-27	PFAM
Pfam:MFS_1	140	376	1.2e-15	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000120540
AA Change: M279K

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000114071
Gene: ENSMUSG00000052562
AA Change: M279K

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
Pfam:Sugar_tr	99	435	1.3e-20	PFAM
Pfam:MFS_1	127	435	1.5e-19	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (60/60)

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A930003A15Rik	T	C	16: 19,883,806	D24G	noncoding transcript	Het
Adam32	A	G	8: 24,901,470	S343P	possibly damaging	Het
Agbl2	G	A	2: 90,797,564	G238R	probably damaging	Het
Ahi1	T	A	10: 20,972,092	D466E	probably benign	Het
Ahnak	T	A	19: 9,001,946	V198E	probably damaging	Het
Ank2	T	A	3: 126,937,785	H658L	possibly damaging	Het
Atp8b5	T	A	4: 43,366,072	I781N	probably damaging	Het
Bloc1s6	A	T	2: 122,742,645	R47*	probably null	Het
Clk2	G	A	3: 89,173,504	V266M	probably damaging	Het
Cul9	A	C	17: 46,530,014	Y777D	probably damaging	Het
Dcp1a	C	T	14: 30,479,598		probably benign	Het
Dcp1a	A	G	14: 30,522,926	T570A	possibly damaging	Het
Dnajb2	T	G	1: 75,243,582	D248E		Het
Dpy19l1	T	C	9: 24,502,895	H79R	probably benign	Het
Elmo1	T	C	13: 20,600,201	S643P	probably damaging	Het
Evi5	A	G	5: 107,818,887		probably null	Het
Fam76b	T	C	9: 13,831,102	C110R	probably damaging	Het
Galnt7	T	A	8: 57,538,188	K429N	probably benign	Het
Gm10142	T	A	10: 77,716,116	C104S	probably damaging	Het
Gm7298	A	C	6: 121,787,443	H1427P	probably benign	Het
Golga7b	A	T	19: 42,266,871	I87F	probably damaging	Het
Gpr165	C	A	X: 96,714,017	D7E	probably benign	Het
Gpr25	C	A	1: 136,260,677	R66L	probably benign	Het
H2-Q2	A	G	17: 35,344,865	N241D	probably benign	Het
Il1a	T	C	2: 129,302,961	D179G	probably benign	Het
Itch	T	C	2: 155,206,383		probably null	Het
Itsn2	T	C	12: 4,662,052	V913A	probably benign	Het
Kdm1b	T	A	13: 47,071,878		probably benign	Het
Lama4	T	C	10: 39,061,379	I655T	possibly damaging	Het
Lats1	T	A	10: 7,705,903	S817R	probably damaging	Het
Lrrc8c	A	T	5: 105,607,867	M503L	probably benign	Het
Mast4	T	C	13: 102,738,721	T1380A	probably damaging	Het
Mfap1a	G	T	2: 121,506,495	T16K	possibly damaging	Het
Mroh2b	C	T	15: 4,931,104	T773I	probably benign	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Nudt7	A	G	8: 114,151,997	Y255C	probably benign	Het
Pfas	T	C	11: 69,000,263	T310A	probably damaging	Het
Pkhd1l1	T	G	15: 44,543,546	I2393R	probably damaging	Het
Pmm1	A	C	15: 81,960,731	L24R	possibly damaging	Het
Pram1	T	C	17: 33,641,164	V235A	probably benign	Het
Prg4	T	C	1: 150,455,126	T599A	unknown	Het
Prpf40b	A	G	15: 99,316,285	K812E	unknown	Het
Qars	G	A	9: 108,509,452	A155T	probably benign	Het
Rftn1	G	T	17: 50,047,380	A318D	probably damaging	Het
Rgs6	A	G	12: 83,137,704		probably benign	Het
Rom1	T	A	19: 8,928,681	R165W	probably damaging	Het
Rps6kb2	T	A	19: 4,156,988		probably benign	Het
Ryr1	A	T	7: 29,069,121	W2808R	probably damaging	Het
Sh3gl1	A	G	17: 56,019,038		probably null	Het
Snx11	A	G	11: 96,769,933	S184P	unknown	Het
Srgap1	A	G	10: 121,804,817	C692R	probably damaging	Het
Srgap3	T	C	6: 112,723,143	N982S	probably damaging	Het
Stac	T	A	9: 111,593,745	D270V	probably benign	Het
Syn3	T	A	10: 86,135,021	I246F	probably benign	Het
Tnr	T	C	1: 159,892,093	V980A	probably damaging	Het
Usp17le	G	T	7: 104,769,794	A47E	possibly damaging	Het
Vmn2r118	T	C	17: 55,610,936	N192S	probably benign	Het
Zmym4	C	A	4: 126,905,369	V725L	possibly damaging	Het

Other mutations in Slc22a30

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00950:Slc22a30	APN	19	8335788	missense	probably benign	0.29
IGL01894:Slc22a30	APN	19	8386657	missense	probably benign	0.28
IGL02795:Slc22a30	APN	19	8400895	missense	probably damaging	1.00
IGL02798:Slc22a30	APN	19	8370085	missense	probably damaging	0.96
IGL03267:Slc22a30	APN	19	8337958	missense	probably benign	0.00
R0089:Slc22a30	UTSW	19	8370197	missense	probably benign	0.03
R0243:Slc22a30	UTSW	19	8345357	missense	probably benign	0.01
R1033:Slc22a30	UTSW	19	8335801	nonsense	probably null
R1781:Slc22a30	UTSW	19	8335772	missense	probably damaging	1.00
R2098:Slc22a30	UTSW	19	8400811	missense	probably damaging	1.00
R3874:Slc22a30	UTSW	19	8336849	missense	probably benign	0.31
R4091:Slc22a30	UTSW	19	8404545	missense	probably damaging	1.00
R4799:Slc22a30	UTSW	19	8344404	missense	probably benign
R5108:Slc22a30	UTSW	19	8386426	missense	probably damaging	1.00
R5191:Slc22a30	UTSW	19	8344393	nonsense	probably null
R5192:Slc22a30	UTSW	19	8344393	nonsense	probably null
R5193:Slc22a30	UTSW	19	8344393	nonsense	probably null
R5195:Slc22a30	UTSW	19	8344393	nonsense	probably null
R5253:Slc22a30	UTSW	19	8344393	nonsense	probably null
R5254:Slc22a30	UTSW	19	8344393	nonsense	probably null
R5255:Slc22a30	UTSW	19	8344393	nonsense	probably null
R5256:Slc22a30	UTSW	19	8344393	nonsense	probably null
R5377:Slc22a30	UTSW	19	8344393	nonsense	probably null
R5378:Slc22a30	UTSW	19	8344393	nonsense	probably null
R5400:Slc22a30	UTSW	19	8344393	nonsense	probably null
R5401:Slc22a30	UTSW	19	8344393	nonsense	probably null
R5481:Slc22a30	UTSW	19	8336837	missense	probably benign	0.01
R5644:Slc22a30	UTSW	19	8404616	missense	possibly damaging	0.72
R5679:Slc22a30	UTSW	19	8335771	missense	possibly damaging	0.90
R5699:Slc22a30	UTSW	19	8344393	nonsense	probably null
R5704:Slc22a30	UTSW	19	8344393	nonsense	probably null
R5706:Slc22a30	UTSW	19	8344393	nonsense	probably null
R5767:Slc22a30	UTSW	19	8344393	nonsense	probably null
R5770:Slc22a30	UTSW	19	8386527	missense	probably damaging	0.99
R5784:Slc22a30	UTSW	19	8344393	nonsense	probably null
R5793:Slc22a30	UTSW	19	8336819	missense	possibly damaging	0.95
R5813:Slc22a30	UTSW	19	8404581	missense	probably benign	0.07
R6101:Slc22a30	UTSW	19	8337868	splice site	probably null
R6105:Slc22a30	UTSW	19	8337868	splice site	probably null
R6327:Slc22a30	UTSW	19	8335722	utr 3 prime	probably benign
R6958:Slc22a30	UTSW	19	8386701	missense	probably damaging	0.98
R7162:Slc22a30	UTSW	19	8336717	splice site	probably null
R7375:Slc22a30	UTSW	19	8404691	missense	probably damaging	1.00
R7572:Slc22a30	UTSW	19	8335708	missense	unknown
R7755:Slc22a30	UTSW	19	8336769	missense	probably damaging	1.00
R8114:Slc22a30	UTSW	19	8404540	nonsense	probably null
R8677:Slc22a30	UTSW	19	8386671	missense	probably benign	0.21
R8854:Slc22a30	UTSW	19	8386390	critical splice donor site	probably null
R8900:Slc22a30	UTSW	19	8337976	missense	probably damaging	1.00
R9185:Slc22a30	UTSW	19	8344553	missense	probably benign	0.03
R9296:Slc22a30	UTSW	19	8386755	missense	probably benign	0.06
R9463:Slc22a30	UTSW	19	8400895	missense	probably damaging	1.00
R9773:Slc22a30	UTSW	19	8344390	missense	probably benign	0.01
Z1088:Slc22a30	UTSW	19	8335775	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCATCTTGGGCACTAACTCATAC -3'
(R):5'- TATGCATTTCAGAAGTGCAGTGC -3'

Sequencing Primer
(F):5'- CTTGGGCACTAACTCATACACATGTG -3'
(R):5'- CAGTGCATTATGTGGCTGAATCATTC -3'

Posted On

2020-07-28