Incidental Mutation 'R8259:Abca15'
ID640438
Institutional Source Beutler Lab
Gene Symbol Abca15
Ensembl Gene ENSMUSG00000054746
Gene NameATP-binding cassette, sub-family A (ABC1), member 15
Synonyms4930500I12Rik
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_177213.3; MGI:2388709

Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R8259 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location120328670-120407687 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 120340199 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 272 (H272L)
Ref Sequence ENSEMBL: ENSMUSP00000075621 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076272] [ENSMUST00000121265]
Predicted Effect probably benign
Transcript: ENSMUST00000076272
AA Change: H272L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000075621
Gene: ENSMUSG00000054746
AA Change: H272L

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 24 464 5.7e-21 PFAM
AAA 550 732 9.14e-11 SMART
Pfam:ABC2_membrane_3 892 1293 7.9e-24 PFAM
AAA 1381 1565 1.16e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121265
AA Change: H272L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000112821
Gene: ENSMUSG00000054746
AA Change: H272L

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 24 464 2.1e-21 PFAM
AAA 550 732 9.14e-11 SMART
Pfam:ABC2_membrane_3 907 1293 1e-25 PFAM
AAA 1381 1565 1.16e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted(2

Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,682,481 E1206G probably benign Het
Abcg5 T G 17: 84,676,095 T144P possibly damaging Het
Adam34 G A 8: 43,651,609 S333L probably benign Het
Adcy6 A G 15: 98,601,038 F294S probably damaging Het
Adhfe1 A G 1: 9,558,192 N263S probably null Het
Aebp2 A T 6: 140,637,727 Q309L possibly damaging Het
Akap7 A G 10: 25,171,156 Y281H probably damaging Het
Aplf T C 6: 87,630,005 R476G probably benign Het
Atg2a G A 19: 6,249,829 A588T probably damaging Het
Birc6 A G 17: 74,598,078 T1289A probably benign Het
Cacna1d A G 14: 30,051,518 S1759P probably benign Het
Calcoco1 T C 15: 102,715,793 D236G probably damaging Het
Camsap2 A T 1: 136,280,339 D470E probably benign Het
Capn8 G T 1: 182,565,133 V25L probably benign Het
Card10 A G 15: 78,776,684 V1041A probably damaging Het
Ccr1 T A 9: 123,964,082 H137L probably damaging Het
Cdh23 A T 10: 60,315,656 D2483E probably damaging Het
Chd2 G T 7: 73,435,784 Q1701K probably benign Het
Ckmt2 T A 13: 91,859,216 R286S probably damaging Het
Clhc1 G A 11: 29,553,746 R54Q probably benign Het
Cntnap3 T A 13: 64,787,867 D394V probably damaging Het
Comp A G 8: 70,379,054 D441G probably damaging Het
Cyp27a1 A T 1: 74,732,055 D133V probably benign Het
Cyp2a12 C T 7: 27,032,658 Q275* probably null Het
Dpy19l2 A G 9: 24,669,406 V213A probably benign Het
Eml1 A T 12: 108,510,199 I283F probably damaging Het
Ep300 A G 15: 81,639,017 T1281A unknown Het
Ercc6l2 G A 13: 63,872,471 E803K Het
Fat3 A G 9: 15,990,591 V3046A possibly damaging Het
Fbxw20 A G 9: 109,234,695 V3A probably benign Het
Fcgr2b A G 1: 170,968,133 S76P possibly damaging Het
Fgg C T 3: 83,010,170 Q169* probably null Het
Flnb A G 14: 7,889,183 Y511C probably damaging Het
Ggt5 G A 10: 75,614,832 V558I probably benign Het
Gm4779 G C X: 101,793,784 T171S possibly damaging Het
Greb1 A T 12: 16,724,924 C157* probably null Het
Grid2ip A G 5: 143,362,589 E145G probably benign Het
Hdac11 T A 6: 91,172,228 V238E probably damaging Het
Herc2 A G 7: 56,205,890 D3858G probably damaging Het
Hoxc4 A G 15: 103,034,739 Y6C probably damaging Het
Incenp A G 19: 9,893,629 L212P unknown Het
Incenp G C 19: 9,893,641 T208R unknown Het
Mctp1 T A 13: 76,801,547 probably null Het
Megf8 T C 7: 25,358,423 M2095T probably benign Het
Mroh2b G A 15: 4,911,909 V308I probably benign Het
Muc1 T A 3: 89,232,034 H580Q probably damaging Het
Naip6 A T 13: 100,316,412 M47K probably benign Het
Nectin3 C T 16: 46,436,391 R419Q probably benign Het
Nlrp4g T G 9: 124,353,392 Y579D noncoding transcript Het
Nrxn1 C A 17: 90,163,821 R1260L probably damaging Het
Nynrin A G 14: 55,863,358 I202V possibly damaging Het
Olfr128 T C 17: 37,923,956 L130P probably damaging Het
Olfr1450 T C 19: 12,954,363 M258T possibly damaging Het
Olfr199 T C 16: 59,216,095 I173V probably benign Het
Olfr78 A G 7: 102,742,827 Y59H probably damaging Het
Pard3 G A 8: 127,371,540 W354* probably null Het
Pcnx3 C T 19: 5,665,384 G1946E probably damaging Het
Peak1 A G 9: 56,259,393 V417A probably damaging Het
Prune2 A G 19: 17,212,308 R3052G unknown Het
Prx T C 7: 27,519,383 L1242P probably damaging Het
Pxylp1 A G 9: 96,825,580 I183T probably benign Het
Ranbp2 A G 10: 58,455,933 E254G probably benign Het
Ren1 C T 1: 133,350,796 R31* probably null Het
Rhot2 C A 17: 25,839,890 R512L probably benign Het
Rpa1 T C 11: 75,302,724 N594D probably benign Het
Rpp14 T G 14: 8,090,526 V150G probably null Het
Rxfp2 T A 5: 150,059,900 I300K probably damaging Het
Sbno1 A T 5: 124,381,696 V1173E probably damaging Het
Scarf1 T A 11: 75,523,863 S486T probably damaging Het
Slc24a4 T C 12: 102,254,669 V455A probably damaging Het
Slitrk1 A G 14: 108,911,221 V686A probably benign Het
Ston2 A T 12: 91,641,680 I882N probably benign Het
Syne2 C A 12: 75,949,369 Q2228K possibly damaging Het
Tcf20 A C 15: 82,852,273 F1659C probably damaging Het
Tenm4 G A 7: 96,867,991 G1430S probably damaging Het
Tlr12 C A 4: 128,617,699 A253S probably benign Het
Tmem87a A G 2: 120,397,447 F73S possibly damaging Het
Trpm1 G A 7: 64,269,029 A1590T probably benign Het
Usp13 C T 3: 32,917,599 Q743* probably null Het
Vmn1r184 T A 7: 26,267,261 M144K probably benign Het
Wee2 A G 6: 40,444,180 D68G probably benign Het
Other mutations in Abca15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Abca15 APN 7 120397054 missense probably damaging 1.00
IGL00505:Abca15 APN 7 120369236 critical splice donor site probably null
IGL00851:Abca15 APN 7 120340007 missense probably damaging 1.00
IGL00985:Abca15 APN 7 120397018 missense probably damaging 1.00
IGL01114:Abca15 APN 7 120361420 missense probably damaging 0.99
IGL01287:Abca15 APN 7 120332858 utr 3 prime probably benign
IGL01333:Abca15 APN 7 120382308 missense probably damaging 1.00
IGL01482:Abca15 APN 7 120382746 missense probably benign 0.00
IGL01610:Abca15 APN 7 120340644 missense probably damaging 0.98
IGL02238:Abca15 APN 7 120396606 missense probably benign 0.02
IGL02377:Abca15 APN 7 120365910 splice site probably benign
IGL02666:Abca15 APN 7 120335208 missense probably damaging 1.00
IGL02836:Abca15 APN 7 120388216 missense probably benign
IGL03337:Abca15 APN 7 120396707 missense probably benign 0.24
IGL03354:Abca15 APN 7 120394488 nonsense probably null
H8562:Abca15 UTSW 7 120374854 splice site probably benign
IGL03098:Abca15 UTSW 7 120388276 splice site probably null
R0029:Abca15 UTSW 7 120346002 missense probably benign 0.01
R0029:Abca15 UTSW 7 120346002 missense probably benign 0.01
R0076:Abca15 UTSW 7 120373685 splice site probably benign
R0165:Abca15 UTSW 7 120350903 splice site probably benign
R0311:Abca15 UTSW 7 120402904 missense probably damaging 0.98
R0387:Abca15 UTSW 7 120332852 critical splice donor site probably null
R0610:Abca15 UTSW 7 120365786 missense possibly damaging 0.75
R0612:Abca15 UTSW 7 120337255 missense probably damaging 1.00
R0704:Abca15 UTSW 7 120354523 missense probably damaging 0.98
R0890:Abca15 UTSW 7 120373713 missense probably benign 0.01
R0961:Abca15 UTSW 7 120360985 nonsense probably null
R1144:Abca15 UTSW 7 120360860 splice site probably benign
R1412:Abca15 UTSW 7 120345323 missense possibly damaging 0.93
R1419:Abca15 UTSW 7 120374902 missense probably benign 0.10
R1467:Abca15 UTSW 7 120340538 splice site probably null
R1467:Abca15 UTSW 7 120340538 splice site probably null
R1469:Abca15 UTSW 7 120382497 missense probably benign 0.00
R1469:Abca15 UTSW 7 120382497 missense probably benign 0.00
R1493:Abca15 UTSW 7 120382290 missense probably benign 0.00
R1513:Abca15 UTSW 7 120340099 missense probably damaging 0.96
R1702:Abca15 UTSW 7 120382702 missense probably benign 0.10
R1857:Abca15 UTSW 7 120361369 missense probably damaging 1.00
R1893:Abca15 UTSW 7 120340553 missense possibly damaging 0.85
R1901:Abca15 UTSW 7 120346099 missense probably damaging 1.00
R1951:Abca15 UTSW 7 120361432 missense probably damaging 1.00
R1953:Abca15 UTSW 7 120361432 missense probably damaging 1.00
R1962:Abca15 UTSW 7 120341245 missense probably damaging 1.00
R2063:Abca15 UTSW 7 120360904 missense possibly damaging 0.61
R2141:Abca15 UTSW 7 120407474 missense probably damaging 1.00
R2145:Abca15 UTSW 7 120354478 missense probably benign 0.08
R2182:Abca15 UTSW 7 120340227 nonsense probably null
R2425:Abca15 UTSW 7 120359810 missense probably damaging 1.00
R2444:Abca15 UTSW 7 120365897 missense probably damaging 1.00
R3023:Abca15 UTSW 7 120382779 missense probably benign 0.40
R3079:Abca15 UTSW 7 120385169 missense probably damaging 1.00
R3106:Abca15 UTSW 7 120396633 missense possibly damaging 0.63
R3622:Abca15 UTSW 7 120350813 nonsense probably null
R4085:Abca15 UTSW 7 120382726 missense probably damaging 1.00
R4233:Abca15 UTSW 7 120402979 nonsense probably null
R4591:Abca15 UTSW 7 120382413 missense probably damaging 1.00
R4612:Abca15 UTSW 7 120335161 missense probably benign 0.03
R4721:Abca15 UTSW 7 120350775 missense probably benign 0.01
R4838:Abca15 UTSW 7 120345300 missense probably benign 0.00
R4940:Abca15 UTSW 7 120332694 missense probably benign
R4963:Abca15 UTSW 7 120360919 missense probably damaging 1.00
R4993:Abca15 UTSW 7 120401718 missense probably damaging 0.99
R5022:Abca15 UTSW 7 120346096 missense probably damaging 0.98
R5030:Abca15 UTSW 7 120340001 missense probably damaging 1.00
R5072:Abca15 UTSW 7 120406975 missense probably damaging 1.00
R5090:Abca15 UTSW 7 120385199 missense probably damaging 1.00
R5309:Abca15 UTSW 7 120345369 missense probably damaging 0.96
R5310:Abca15 UTSW 7 120332616 missense possibly damaging 0.46
R5312:Abca15 UTSW 7 120345369 missense probably damaging 0.96
R5482:Abca15 UTSW 7 120369147 missense probably damaging 1.00
R5596:Abca15 UTSW 7 120401749 missense possibly damaging 0.94
R5853:Abca15 UTSW 7 120340583 missense probably benign 0.00
R5950:Abca15 UTSW 7 120382656 missense probably damaging 1.00
R5953:Abca15 UTSW 7 120361018 missense probably damaging 1.00
R6072:Abca15 UTSW 7 120388258 missense probably damaging 0.98
R6131:Abca15 UTSW 7 120340205 missense probably benign 0.03
R6132:Abca15 UTSW 7 120361420 missense probably benign 0.14
R6136:Abca15 UTSW 7 120340049 missense possibly damaging 0.81
R6207:Abca15 UTSW 7 120373794 missense probably benign 0.01
R6315:Abca15 UTSW 7 120346092 missense probably damaging 1.00
R6417:Abca15 UTSW 7 120397128 missense possibly damaging 0.95
R6420:Abca15 UTSW 7 120397128 missense possibly damaging 0.95
R6595:Abca15 UTSW 7 120394487 missense probably benign 0.00
R6653:Abca15 UTSW 7 120346006 missense probably benign 0.03
R6859:Abca15 UTSW 7 120402994 nonsense probably null
R6983:Abca15 UTSW 7 120354463 missense probably benign 0.26
R7127:Abca15 UTSW 7 120332602 missense probably benign 0.06
R7205:Abca15 UTSW 7 120394364 missense possibly damaging 0.89
R7336:Abca15 UTSW 7 120388233 missense possibly damaging 0.66
R7426:Abca15 UTSW 7 120345998 missense possibly damaging 0.88
R7745:Abca15 UTSW 7 120332217 missense probably damaging 1.00
R7751:Abca15 UTSW 7 120365821 missense possibly damaging 0.72
R7806:Abca15 UTSW 7 120332836 missense probably damaging 0.96
R8042:Abca15 UTSW 7 120403010 missense possibly damaging 0.95
R8098:Abca15 UTSW 7 120361396 missense probably benign 0.09
R8153:Abca15 UTSW 7 120400589 missense probably damaging 1.00
R8247:Abca15 UTSW 7 120337222 missense possibly damaging 0.83
R8272:Abca15 UTSW 7 120407442 missense probably damaging 1.00
R8295:Abca15 UTSW 7 120374965 missense probably benign 0.00
RF018:Abca15 UTSW 7 120394460 missense possibly damaging 0.50
Z1176:Abca15 UTSW 7 120346026 missense probably benign 0.22
Z1176:Abca15 UTSW 7 120382505 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTTCTCCTTTAGGGTACATCACGG -3'
(R):5'- AATTGCCAGTGAAACAGAACTG -3'

Sequencing Primer
(F):5'- TCCTGGCTGTGCAACATG -3'
(R):5'- TGCCAGTGAAACAGAACTGTCTATAG -3'
Posted On2020-07-28