Incidental Mutation 'R0095:Cutc'
ID64045
Institutional Source Beutler Lab
Gene Symbol Cutc
Ensembl Gene ENSMUSG00000025193
Gene NamecutC copper transporter
Synonyms2310039I18Rik, CGI-32
MMRRC Submission 038381-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.271) question?
Stock #R0095 (G1)
Quality Score104
Status Not validated
Chromosome19
Chromosomal Location43752996-43768638 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43753199 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 13 (W13R)
Ref Sequence ENSEMBL: ENSMUSP00000118906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026199] [ENSMUST00000045562] [ENSMUST00000112047] [ENSMUST00000153295]
Predicted Effect probably benign
Transcript: ENSMUST00000026199
AA Change: W13R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026199
Gene: ENSMUSG00000025193
AA Change: W13R

DomainStartEndE-ValueType
Pfam:CutC 25 216 1.1e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000045562
SMART Domains Protein: ENSMUSP00000041820
Gene: ENSMUSG00000040018

DomainStartEndE-ValueType
Pfam:COX15-CtaA 73 402 2.3e-112 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112047
AA Change: W13R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107678
Gene: ENSMUSG00000025193
AA Change: W13R

DomainStartEndE-ValueType
Pfam:CutC 25 226 7.8e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153295
AA Change: W13R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118906
Gene: ENSMUSG00000025193
AA Change: W13R

DomainStartEndE-ValueType
Pfam:CutC 23 224 7.7e-82 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the CUT family of copper transporters are associated with copper homeostasis and are involved in the uptake, storage, delivery, and efflux of copper (Gupta et al., 1995 [PubMed 7635807]; Li et al., 2005 [PubMed 16182249]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anxa8 G A 14: 34,086,071 A6T probably benign Het
Bicc1 T A 10: 70,961,158 I42F probably damaging Het
F5 A T 1: 164,191,968 R671* probably null Het
Fam84b T C 15: 60,823,576 Y107C probably damaging Het
Fer A T 17: 63,941,326 E361V possibly damaging Het
Hnrnpa3 G T 2: 75,661,696 R52L probably damaging Het
Igsf10 A T 3: 59,331,196 Y521* probably null Het
Mmp1a G A 9: 7,465,620 G186D possibly damaging Het
Naip1 T C 13: 100,423,083 T1138A probably benign Het
Necab1 T A 4: 14,960,027 N307Y possibly damaging Het
Olfr510 A C 7: 108,668,045 I210L probably benign Het
Plekha5 T C 6: 140,528,597 F84L probably damaging Het
Rpl6 T G 5: 121,205,839 V115G possibly damaging Het
Sec16a A T 2: 26,425,760 probably null Het
Tpsg1 T C 17: 25,372,554 W43R probably damaging Het
Unc45a T C 7: 80,329,543 D567G probably damaging Het
Usp30 T A 5: 114,105,840 F157I probably damaging Het
Zfp345 T A 2: 150,472,300 H439L probably damaging Het
Other mutations in Cutc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03245:Cutc APN 19 43768182 missense possibly damaging 0.83
P0028:Cutc UTSW 19 43764969 missense possibly damaging 0.84
PIT4305001:Cutc UTSW 19 43768269 missense probably damaging 0.99
R0479:Cutc UTSW 19 43768216 missense probably damaging 1.00
R5635:Cutc UTSW 19 43755630 missense probably benign 0.09
R5898:Cutc UTSW 19 43760029 missense probably benign 0.00
R6150:Cutc UTSW 19 43759889 missense probably damaging 1.00
R6217:Cutc UTSW 19 43759997 missense probably damaging 0.99
R6392:Cutc UTSW 19 43760050 missense possibly damaging 0.58
R7573:Cutc UTSW 19 43759943 missense probably benign 0.03
R8400:Cutc UTSW 19 43753205 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGAACAAGCACTTCCGGGTCAGG -3'
(R):5'- TGTTACGCAATGGCTGTGGGAAC -3'

Sequencing Primer
(F):5'- CCCCTCGCGCTAGGTTG -3'
(R):5'- CTAGGTTGTAGAGCTGTCACCAC -3'
Posted On2013-08-06