Incidental Mutation 'R8259:Greb1'
ID640456
Institutional Source Beutler Lab
Gene Symbol Greb1
Ensembl Gene ENSMUSG00000036523
Gene Namegene regulated by estrogen in breast cancer protein
Synonyms5730583K22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8259 (G1)
Quality Score171.009
Status Validated
Chromosome12
Chromosomal Location16670615-16800886 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 16724924 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 157 (C157*)
Ref Sequence ENSEMBL: ENSMUSP00000044454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048064] [ENSMUST00000159120] [ENSMUST00000162112]
Predicted Effect probably null
Transcript: ENSMUST00000048064
AA Change: C157*
SMART Domains Protein: ENSMUSP00000044454
Gene: ENSMUSG00000036523
AA Change: C157*

DomainStartEndE-ValueType
Pfam:GREB1 1 1954 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000159120
AA Change: C157*
SMART Domains Protein: ENSMUSP00000125339
Gene: ENSMUSG00000036523
AA Change: C157*

DomainStartEndE-ValueType
low complexity region 52 71 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 437 453 N/A INTRINSIC
low complexity region 480 503 N/A INTRINSIC
low complexity region 631 643 N/A INTRINSIC
low complexity region 1100 1118 N/A INTRINSIC
low complexity region 1196 1207 N/A INTRINSIC
low complexity region 1251 1265 N/A INTRINSIC
low complexity region 1596 1607 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000162112
AA Change: C157*
SMART Domains Protein: ENSMUSP00000124348
Gene: ENSMUSG00000036523
AA Change: C157*

DomainStartEndE-ValueType
low complexity region 52 71 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 437 453 N/A INTRINSIC
low complexity region 480 503 N/A INTRINSIC
low complexity region 631 643 N/A INTRINSIC
low complexity region 1128 1146 N/A INTRINSIC
low complexity region 1224 1235 N/A INTRINSIC
low complexity region 1279 1293 N/A INTRINSIC
low complexity region 1624 1635 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is an estrogen-responsive gene that is an early response gene in the estrogen receptor-regulated pathway. It is thought to play an important role in hormone-responsive tissues and cancer. Three alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,682,481 E1206G probably benign Het
Abca15 A T 7: 120,340,199 H272L probably benign Het
Abcg5 T G 17: 84,676,095 T144P possibly damaging Het
Adam34 G A 8: 43,651,609 S333L probably benign Het
Adcy6 A G 15: 98,601,038 F294S probably damaging Het
Adhfe1 A G 1: 9,558,192 N263S probably null Het
Aebp2 A T 6: 140,637,727 Q309L possibly damaging Het
Akap7 A G 10: 25,171,156 Y281H probably damaging Het
Aplf T C 6: 87,630,005 R476G probably benign Het
Atg2a G A 19: 6,249,829 A588T probably damaging Het
Birc6 A G 17: 74,598,078 T1289A probably benign Het
Cacna1d A G 14: 30,051,518 S1759P probably benign Het
Calcoco1 T C 15: 102,715,793 D236G probably damaging Het
Camsap2 A T 1: 136,280,339 D470E probably benign Het
Capn8 G T 1: 182,565,133 V25L probably benign Het
Card10 A G 15: 78,776,684 V1041A probably damaging Het
Ccr1 T A 9: 123,964,082 H137L probably damaging Het
Cdh23 A T 10: 60,315,656 D2483E probably damaging Het
Chd2 G T 7: 73,435,784 Q1701K probably benign Het
Ckmt2 T A 13: 91,859,216 R286S probably damaging Het
Clhc1 G A 11: 29,553,746 R54Q probably benign Het
Cntnap3 T A 13: 64,787,867 D394V probably damaging Het
Comp A G 8: 70,379,054 D441G probably damaging Het
Cyp20a1 G A 1: 60,352,171 probably null Het
Cyp27a1 A T 1: 74,732,055 D133V probably benign Het
Cyp2a12 C T 7: 27,032,658 Q275* probably null Het
Dnhd1 A T 7: 105,694,788 I1780L probably benign Het
Dpy19l2 A G 9: 24,669,406 V213A probably benign Het
Eml1 A T 12: 108,510,199 I283F probably damaging Het
Ep300 A G 15: 81,639,017 T1281A unknown Het
Ercc6l2 G A 13: 63,872,471 E803K Het
Fat3 A G 9: 15,990,591 V3046A possibly damaging Het
Fbxw20 A G 9: 109,234,695 V3A probably benign Het
Fcgr2b A G 1: 170,968,133 S76P possibly damaging Het
Fgg C T 3: 83,010,170 Q169* probably null Het
Flnb A G 14: 7,889,183 Y511C probably damaging Het
Ggt5 G A 10: 75,614,832 V558I probably benign Het
Gm4779 G C X: 101,793,784 T171S possibly damaging Het
Grid2ip A G 5: 143,362,589 E145G probably benign Het
Hdac11 T A 6: 91,172,228 V238E probably damaging Het
Herc2 A G 7: 56,205,890 D3858G probably damaging Het
Hoxc4 A G 15: 103,034,739 Y6C probably damaging Het
Incenp A G 19: 9,893,629 L212P unknown Het
Incenp G C 19: 9,893,641 T208R unknown Het
Mctp1 T A 13: 76,801,547 probably null Het
Megf8 T C 7: 25,358,423 M2095T probably benign Het
Mroh2b G A 15: 4,911,909 V308I probably benign Het
Muc1 T A 3: 89,232,034 H580Q probably damaging Het
Naip6 A T 13: 100,316,412 M47K probably benign Het
Nectin3 C T 16: 46,436,391 R419Q probably benign Het
Nlrp4g T G 9: 124,353,392 Y579D noncoding transcript Het
Nrxn1 C A 17: 90,163,821 R1260L probably damaging Het
Nynrin A G 14: 55,863,358 I202V possibly damaging Het
Olfr128 T C 17: 37,923,956 L130P probably damaging Het
Olfr1450 T C 19: 12,954,363 M258T possibly damaging Het
Olfr199 T C 16: 59,216,095 I173V probably benign Het
Olfr78 A G 7: 102,742,827 Y59H probably damaging Het
Pard3 G A 8: 127,371,540 W354* probably null Het
Pcnx3 C T 19: 5,665,384 G1946E probably damaging Het
Peak1 A G 9: 56,259,393 V417A probably damaging Het
Prune2 A G 19: 17,212,308 R3052G unknown Het
Prx T C 7: 27,519,383 L1242P probably damaging Het
Pxylp1 A G 9: 96,825,580 I183T probably benign Het
Ranbp2 A G 10: 58,455,933 E254G probably benign Het
Ren1 C T 1: 133,350,796 R31* probably null Het
Rhot2 C A 17: 25,839,890 R512L probably benign Het
Rpa1 T C 11: 75,302,724 N594D probably benign Het
Rpp14 T G 14: 8,090,526 V150G probably null Het
Rxfp2 T A 5: 150,059,900 I300K probably damaging Het
Sbno1 A T 5: 124,381,696 V1173E probably damaging Het
Scarf1 T A 11: 75,523,863 S486T probably damaging Het
Slc24a4 T C 12: 102,254,669 V455A probably damaging Het
Slitrk1 A G 14: 108,911,221 V686A probably benign Het
Ston2 A T 12: 91,641,680 I882N probably benign Het
Syne2 C A 12: 75,949,369 Q2228K possibly damaging Het
Tcf20 A C 15: 82,852,273 F1659C probably damaging Het
Tenm4 G A 7: 96,867,991 G1430S probably damaging Het
Tlr12 C A 4: 128,617,699 A253S probably benign Het
Tmem87a A G 2: 120,397,447 F73S possibly damaging Het
Trpm1 G A 7: 64,269,029 A1590T probably benign Het
Usp13 C T 3: 32,917,599 Q743* probably null Het
Vmn1r184 T A 7: 26,267,261 M144K probably benign Het
Wee2 A G 6: 40,444,180 D68G probably benign Het
Other mutations in Greb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Greb1 APN 12 16711961 missense probably damaging 1.00
IGL01316:Greb1 APN 12 16698586 missense probably benign 0.04
IGL01464:Greb1 APN 12 16714826 missense probably damaging 0.99
IGL01474:Greb1 APN 12 16684501 missense probably benign
IGL01522:Greb1 APN 12 16701201 missense probably damaging 1.00
IGL01824:Greb1 APN 12 16711716 nonsense probably null
IGL01837:Greb1 APN 12 16684451 missense probably benign 0.19
IGL01991:Greb1 APN 12 16699681 missense probably damaging 1.00
IGL01996:Greb1 APN 12 16690845 missense possibly damaging 0.70
IGL02213:Greb1 APN 12 16706232 missense probably damaging 1.00
IGL02267:Greb1 APN 12 16717208 missense probably benign 0.00
IGL02512:Greb1 APN 12 16692712 missense possibly damaging 0.79
IGL02583:Greb1 APN 12 16706295 splice site probably benign
IGL02613:Greb1 APN 12 16739888 critical splice donor site probably null
IGL02648:Greb1 APN 12 16708682 missense probably damaging 1.00
IGL02679:Greb1 APN 12 16708723 missense probably damaging 1.00
Eared UTSW 12 16673863 missense probably damaging 1.00
Humpback UTSW 12 16701171 missense probably damaging 1.00
pied_billed UTSW 12 16724857 missense possibly damaging 0.79
G1patch:Greb1 UTSW 12 16688567 missense probably damaging 1.00
IGL03048:Greb1 UTSW 12 16733331 missense probably damaging 1.00
R0083:Greb1 UTSW 12 16696451 missense probably benign
R0100:Greb1 UTSW 12 16680224 missense probably benign 0.41
R0100:Greb1 UTSW 12 16680224 missense probably benign 0.41
R0220:Greb1 UTSW 12 16682286 missense probably damaging 1.00
R0245:Greb1 UTSW 12 16696456 missense probably damaging 1.00
R0540:Greb1 UTSW 12 16682193 missense probably damaging 1.00
R0547:Greb1 UTSW 12 16723411 missense probably benign
R0563:Greb1 UTSW 12 16680267 missense probably benign 0.23
R0607:Greb1 UTSW 12 16682193 missense probably damaging 1.00
R0610:Greb1 UTSW 12 16696442 missense probably benign
R0652:Greb1 UTSW 12 16696456 missense probably damaging 1.00
R0659:Greb1 UTSW 12 16680212 missense probably damaging 0.99
R0945:Greb1 UTSW 12 16673802 missense probably benign 0.31
R1055:Greb1 UTSW 12 16682251 missense probably damaging 0.98
R1445:Greb1 UTSW 12 16707851 missense probably damaging 1.00
R1471:Greb1 UTSW 12 16711774 missense probably damaging 0.97
R1503:Greb1 UTSW 12 16724819 nonsense probably null
R1566:Greb1 UTSW 12 16711828 missense possibly damaging 0.94
R1614:Greb1 UTSW 12 16701171 missense probably damaging 1.00
R1623:Greb1 UTSW 12 16674770 missense probably damaging 1.00
R1751:Greb1 UTSW 12 16723438 splice site probably benign
R1778:Greb1 UTSW 12 16690894 missense probably benign
R1842:Greb1 UTSW 12 16696243 missense probably damaging 1.00
R2040:Greb1 UTSW 12 16702650 missense probably damaging 1.00
R2153:Greb1 UTSW 12 16699532 missense probably damaging 1.00
R2178:Greb1 UTSW 12 16696387 missense probably damaging 1.00
R2194:Greb1 UTSW 12 16690908 missense probably benign 0.08
R2248:Greb1 UTSW 12 16680378 missense possibly damaging 0.90
R2474:Greb1 UTSW 12 16714953 missense possibly damaging 0.93
R2509:Greb1 UTSW 12 16724922 missense probably damaging 1.00
R2860:Greb1 UTSW 12 16711745 missense probably benign 0.28
R2861:Greb1 UTSW 12 16711745 missense probably benign 0.28
R2862:Greb1 UTSW 12 16711745 missense probably benign 0.28
R2866:Greb1 UTSW 12 16699550 missense probably damaging 1.00
R2890:Greb1 UTSW 12 16704478 missense probably damaging 1.00
R3056:Greb1 UTSW 12 16688591 missense probably damaging 0.96
R3863:Greb1 UTSW 12 16702420 missense probably damaging 1.00
R3864:Greb1 UTSW 12 16702420 missense probably damaging 1.00
R3956:Greb1 UTSW 12 16682299 missense probably damaging 1.00
R4493:Greb1 UTSW 12 16698610 missense probably benign 0.14
R4548:Greb1 UTSW 12 16699675 missense probably damaging 1.00
R4683:Greb1 UTSW 12 16711773 missense possibly damaging 0.75
R4739:Greb1 UTSW 12 16696328 missense probably damaging 1.00
R4770:Greb1 UTSW 12 16681356 missense probably benign 0.03
R4838:Greb1 UTSW 12 16684360 critical splice donor site probably null
R4925:Greb1 UTSW 12 16681471 missense probably damaging 1.00
R4982:Greb1 UTSW 12 16724761 missense probably damaging 0.98
R5009:Greb1 UTSW 12 16724857 missense possibly damaging 0.79
R5086:Greb1 UTSW 12 16708022 intron probably benign
R5213:Greb1 UTSW 12 16714790 nonsense probably null
R5310:Greb1 UTSW 12 16716759 missense probably benign 0.09
R5353:Greb1 UTSW 12 16688566 nonsense probably null
R5544:Greb1 UTSW 12 16673796 missense probably damaging 1.00
R5605:Greb1 UTSW 12 16708726 missense probably damaging 0.96
R5708:Greb1 UTSW 12 16673842 missense probably benign 0.11
R5837:Greb1 UTSW 12 16688585 missense probably damaging 1.00
R5890:Greb1 UTSW 12 16733421 missense possibly damaging 0.90
R5938:Greb1 UTSW 12 16717258 missense probably damaging 1.00
R6049:Greb1 UTSW 12 16681394 missense probably damaging 0.99
R6093:Greb1 UTSW 12 16684486 missense probably benign
R6120:Greb1 UTSW 12 16708621 missense probably damaging 0.99
R6175:Greb1 UTSW 12 16674770 missense probably damaging 1.00
R6247:Greb1 UTSW 12 16716675 missense probably damaging 1.00
R6274:Greb1 UTSW 12 16735151 missense probably damaging 0.97
R6376:Greb1 UTSW 12 16699579 missense probably damaging 0.97
R6523:Greb1 UTSW 12 16684373 missense possibly damaging 0.51
R6557:Greb1 UTSW 12 16710383 missense probably benign 0.00
R6602:Greb1 UTSW 12 16709440 missense probably benign 0.44
R6621:Greb1 UTSW 12 16692717 missense probably damaging 1.00
R6645:Greb1 UTSW 12 16698579 missense probably benign 0.07
R6725:Greb1 UTSW 12 16688567 missense probably damaging 1.00
R6750:Greb1 UTSW 12 16688583 missense probably benign 0.05
R6863:Greb1 UTSW 12 16684420 missense probably damaging 1.00
R6914:Greb1 UTSW 12 16707902 missense probably damaging 0.97
R6996:Greb1 UTSW 12 16723354 missense probably benign 0.00
R7083:Greb1 UTSW 12 16723314 missense probably benign
R7147:Greb1 UTSW 12 16733427 missense probably damaging 1.00
R7238:Greb1 UTSW 12 16674672 missense probably damaging 0.99
R7290:Greb1 UTSW 12 16711738 missense probably damaging 1.00
R7358:Greb1 UTSW 12 16724881 missense probably damaging 1.00
R7395:Greb1 UTSW 12 16709430 critical splice donor site probably null
R7526:Greb1 UTSW 12 16716765 missense probably benign 0.00
R7530:Greb1 UTSW 12 16717206 missense probably benign 0.02
R7536:Greb1 UTSW 12 16682185 missense probably damaging 1.00
R7643:Greb1 UTSW 12 16711996 missense probably damaging 0.99
R7732:Greb1 UTSW 12 16673863 missense probably damaging 1.00
R7740:Greb1 UTSW 12 16740121 start gained probably benign
R7747:Greb1 UTSW 12 16674795 missense probably benign 0.01
R7760:Greb1 UTSW 12 16723416 missense probably benign
R7937:Greb1 UTSW 12 16716669 missense probably damaging 0.99
R8043:Greb1 UTSW 12 16711789 missense probably damaging 1.00
R8553:Greb1 UTSW 12 16723327 missense probably benign 0.00
R8559:Greb1 UTSW 12 16696435 missense probably damaging 1.00
R8690:Greb1 UTSW 12 16696547 missense probably benign 0.03
R8830:Greb1 UTSW 12 16688519 missense probably benign 0.35
Z1176:Greb1 UTSW 12 16696756 missense probably benign 0.00
Z1177:Greb1 UTSW 12 16702491 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAATGCATACCCAGCTCCCTTC -3'
(R):5'- AATCTCTCAAGCTTGCCCAG -3'

Sequencing Primer
(F):5'- GCAGATTGCAGCCCCTC -3'
(R):5'- GGGTCCAGTCTCTTCGGTC -3'
Posted On2020-07-28