Mutagenetix > Incidental Mutation

Incidental Mutation 'R8259:Cntnap3'

640462

Institutional Source

Beutler Lab

Gene Symbol

Cntnap3

Ensembl Gene

ENSMUSG00000033063

Gene Name

contactin associated protein-like 3

Synonyms

MMRRC Submission

067650-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.057) question?

Stock #

R8259 (G1)

Quality Score

133.008

Status

Validated

Chromosome

Chromosomal Location

64736182-64903955 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 64787867 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 394 (D394V)

Ref Sequence

ENSEMBL: ENSMUSP00000089140 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091554]

AlphaFold

E9PY62

Predicted Effect

probably damaging
Transcript: ENSMUST00000091554
AA Change: D394V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000089140
Gene: ENSMUSG00000033063
AA Change: D394V

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
FA58C	33	180	4.88e-17	SMART
LamG	207	345	1.47e-11	SMART
LamG	394	525	1.43e-23	SMART
EGF	553	587	1.33e-1	SMART
FBG	590	775	6.76e-1	SMART
LamG	815	942	1.89e-32	SMART
EGF_like	963	999	6.28e1	SMART
LamG	1040	1178	9.46e-15	SMART
transmembrane domain	1245	1267	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

100% (82/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NCP family of cell-recognition molecules. This family represents a distinct subgroup of the neurexins. NCP proteins mediate neuron-glial interactions in vertebrates and glial-glial contact in invertebrates. The protein encoded by this gene may play a role in cell recognition within the nervous system. Alternatively spliced transcript variants encoding different isoforms have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	T	C	1: 26,682,481	E1206G	probably benign	Het
Abca15	A	T	7: 120,340,199	H272L	probably benign	Het
Abcg5	T	G	17: 84,676,095	T144P	possibly damaging	Het
Adam34	G	A	8: 43,651,609	S333L	probably benign	Het
Adcy6	A	G	15: 98,601,038	F294S	probably damaging	Het
Adhfe1	A	G	1: 9,558,192	N263S	probably null	Het
Aebp2	A	T	6: 140,637,727	Q309L	possibly damaging	Het
Akap7	A	G	10: 25,171,156	Y281H	probably damaging	Het
Aplf	T	C	6: 87,630,005	R476G	probably benign	Het
Atg2a	G	A	19: 6,249,829	A588T	probably damaging	Het
Birc6	A	G	17: 74,598,078	T1289A	probably benign	Het
Cacna1d	A	G	14: 30,051,518	S1759P	probably benign	Het
Calcoco1	T	C	15: 102,715,793	D236G	probably damaging	Het
Camsap2	A	T	1: 136,280,339	D470E	probably benign	Het
Capn8	G	T	1: 182,565,133	V25L	probably benign	Het
Card10	A	G	15: 78,776,684	V1041A	probably damaging	Het
Ccr1	T	A	9: 123,964,082	H137L	probably damaging	Het
Cdh23	A	T	10: 60,315,656	D2483E	probably damaging	Het
Chd2	G	T	7: 73,435,784	Q1701K	probably benign	Het
Ckmt2	T	A	13: 91,859,216	R286S	probably damaging	Het
Clhc1	G	A	11: 29,553,746	R54Q	probably benign	Het
Comp	A	G	8: 70,379,054	D441G	probably damaging	Het
Cyp20a1	G	A	1: 60,352,171		probably null	Het
Cyp27a1	A	T	1: 74,732,055	D133V	probably benign	Het
Cyp2a12	C	T	7: 27,032,658	Q275*	probably null	Het
Dnhd1	A	T	7: 105,694,788	I1780L	probably benign	Het
Dpy19l2	A	G	9: 24,669,406	V213A	probably benign	Het
Eml1	A	T	12: 108,510,199	I283F	probably damaging	Het
Ep300	A	G	15: 81,639,017	T1281A	unknown	Het
Ercc6l2	G	A	13: 63,872,471	E803K		Het
Fat3	A	G	9: 15,990,591	V3046A	possibly damaging	Het
Fbxw20	A	G	9: 109,234,695	V3A	probably benign	Het
Fcgr2b	A	G	1: 170,968,133	S76P	possibly damaging	Het
Fgg	C	T	3: 83,010,170	Q169*	probably null	Het
Flnb	A	G	14: 7,889,183	Y511C	probably damaging	Het
Ggt5	G	A	10: 75,614,832	V558I	probably benign	Het
Gm4779	G	C	X: 101,793,784	T171S	possibly damaging	Het
Greb1	A	T	12: 16,724,924	C157*	probably null	Het
Grid2ip	A	G	5: 143,362,589	E145G	probably benign	Het
Hdac11	T	A	6: 91,172,228	V238E	probably damaging	Het
Herc2	A	G	7: 56,205,890	D3858G	probably damaging	Het
Hoxc4	A	G	15: 103,034,739	Y6C	probably damaging	Het
Incenp	A	G	19: 9,893,629	L212P	unknown	Het
Incenp	G	C	19: 9,893,641	T208R	unknown	Het
Mctp1	T	A	13: 76,801,547		probably null	Het
Megf8	T	C	7: 25,358,423	M2095T	probably benign	Het
Mroh2b	G	A	15: 4,911,909	V308I	probably benign	Het
Muc1	T	A	3: 89,232,034	H580Q	probably damaging	Het
Naip6	A	T	13: 100,316,412	M47K	probably benign	Het
Nectin3	C	T	16: 46,436,391	R419Q	probably benign	Het
Nlrp4g	T	G	9: 124,353,392	Y579D	noncoding transcript	Het
Nrxn1	C	A	17: 90,163,821	R1260L	probably damaging	Het
Nynrin	A	G	14: 55,863,358	I202V	possibly damaging	Het
Olfr128	T	C	17: 37,923,956	L130P	probably damaging	Het
Olfr1450	T	C	19: 12,954,363	M258T	possibly damaging	Het
Olfr199	T	C	16: 59,216,095	I173V	probably benign	Het
Olfr78	A	G	7: 102,742,827	Y59H	probably damaging	Het
Pard3	G	A	8: 127,371,540	W354*	probably null	Het
Pcnx3	C	T	19: 5,665,384	G1946E	probably damaging	Het
Peak1	A	G	9: 56,259,393	V417A	probably damaging	Het
Prune2	A	G	19: 17,212,308	R3052G	unknown	Het
Prx	T	C	7: 27,519,383	L1242P	probably damaging	Het
Pxylp1	A	G	9: 96,825,580	I183T	probably benign	Het
Ranbp2	A	G	10: 58,455,933	E254G	probably benign	Het
Ren1	C	T	1: 133,350,796	R31*	probably null	Het
Rhot2	C	A	17: 25,839,890	R512L	probably benign	Het
Rpa1	T	C	11: 75,302,724	N594D	probably benign	Het
Rpp14	T	G	14: 8,090,526	V150G	probably null	Het
Rxfp2	T	A	5: 150,059,900	I300K	probably damaging	Het
Sbno1	A	T	5: 124,381,696	V1173E	probably damaging	Het
Scarf1	T	A	11: 75,523,863	S486T	probably damaging	Het
Slc24a4	T	C	12: 102,254,669	V455A	probably damaging	Het
Slitrk1	A	G	14: 108,911,221	V686A	probably benign	Het
Ston2	A	T	12: 91,641,680	I882N	probably benign	Het
Syne2	C	A	12: 75,949,369	Q2228K	possibly damaging	Het
Tcf20	A	C	15: 82,852,273	F1659C	probably damaging	Het
Tenm4	G	A	7: 96,867,991	G1430S	probably damaging	Het
Tlr12	C	A	4: 128,617,699	A253S	probably benign	Het
Tmem87a	A	G	2: 120,397,447	F73S	possibly damaging	Het
Trpm1	G	A	7: 64,269,029	A1590T	probably benign	Het
Usp13	C	T	3: 32,917,599	Q743*	probably null	Het
Vmn1r184	T	A	7: 26,267,261	M144K	probably benign	Het
Wee2	A	G	6: 40,444,180	D68G	probably benign	Het

Other mutations in Cntnap3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00433:Cntnap3	APN	13	64772731	missense	probably damaging	1.00
IGL00782:Cntnap3	APN	13	64745805	splice site	probably benign
IGL00976:Cntnap3	APN	13	64794352	missense	probably damaging	1.00
IGL01319:Cntnap3	APN	13	64787837	missense	probably damaging	1.00
IGL01610:Cntnap3	APN	13	64757301	missense	probably damaging	0.98
IGL01861:Cntnap3	APN	13	64799108	missense	probably damaging	1.00
IGL02127:Cntnap3	APN	13	64799064	splice site	probably benign
IGL02133:Cntnap3	APN	13	64751673	splice site	probably benign
IGL02251:Cntnap3	APN	13	64762036	missense	probably damaging	1.00
IGL02272:Cntnap3	APN	13	64757411	missense	probably damaging	1.00
IGL02370:Cntnap3	APN	13	64751751	missense	probably benign
IGL02456:Cntnap3	APN	13	64799058	splice site	probably benign
IGL02589:Cntnap3	APN	13	64792430	missense	probably benign	0.08
IGL02695:Cntnap3	APN	13	64772132	missense	probably benign	0.01
IGL02850:Cntnap3	APN	13	64757409	missense	probably damaging	1.00
IGL03038:Cntnap3	APN	13	64741025	missense	possibly damaging	0.50
IGL03188:Cntnap3	APN	13	64781745	missense	probably damaging	0.97
IGL03327:Cntnap3	APN	13	64887768	nonsense	probably null
PIT4480001:Cntnap3	UTSW	13	64757210	missense	probably damaging	1.00
R0309:Cntnap3	UTSW	13	64757436	splice site	probably benign
R0422:Cntnap3	UTSW	13	64757285	missense	probably damaging	0.96
R0463:Cntnap3	UTSW	13	64778876	missense	probably damaging	1.00
R0491:Cntnap3	UTSW	13	64762045	missense	probably benign	0.01
R0499:Cntnap3	UTSW	13	64858678	missense	probably benign	0.33
R0550:Cntnap3	UTSW	13	64762000	missense	possibly damaging	0.86
R0613:Cntnap3	UTSW	13	64758414	missense	probably damaging	1.00
R0666:Cntnap3	UTSW	13	64757397	missense	probably damaging	1.00
R0840:Cntnap3	UTSW	13	64787910	missense	possibly damaging	0.94
R1577:Cntnap3	UTSW	13	64758290	missense	probably damaging	1.00
R1716:Cntnap3	UTSW	13	64762002	missense	probably damaging	1.00
R1732:Cntnap3	UTSW	13	64740812	critical splice donor site	probably null
R1739:Cntnap3	UTSW	13	64740592	missense	probably benign	0.17
R1905:Cntnap3	UTSW	13	64903764	missense	probably benign	0.04
R1988:Cntnap3	UTSW	13	64758390	missense	probably damaging	1.00
R2086:Cntnap3	UTSW	13	64794262	missense	possibly damaging	0.76
R3732:Cntnap3	UTSW	13	64740999	missense	possibly damaging	0.73
R3808:Cntnap3	UTSW	13	64781804	missense	probably damaging	0.96
R3809:Cntnap3	UTSW	13	64781804	missense	probably damaging	0.96
R4384:Cntnap3	UTSW	13	64748460	missense	probably damaging	1.00
R4433:Cntnap3	UTSW	13	64778853	missense	possibly damaging	0.92
R4631:Cntnap3	UTSW	13	64778883	missense	probably benign	0.04
R4645:Cntnap3	UTSW	13	64778788	critical splice donor site	probably null
R4702:Cntnap3	UTSW	13	64778862	missense	probably benign	0.17
R4876:Cntnap3	UTSW	13	64787706	missense	probably benign	0.00
R4994:Cntnap3	UTSW	13	64761984	missense	possibly damaging	0.55
R5043:Cntnap3	UTSW	13	64794348	missense	probably damaging	1.00
R5214:Cntnap3	UTSW	13	64762010	missense	probably damaging	1.00
R5403:Cntnap3	UTSW	13	64761978	missense	possibly damaging	0.90
R5571:Cntnap3	UTSW	13	64903758	missense	probably damaging	0.98
R5587:Cntnap3	UTSW	13	64746738	missense	probably damaging	1.00
R5695:Cntnap3	UTSW	13	64787955	missense	probably damaging	0.99
R5834:Cntnap3	UTSW	13	64748577	missense	probably benign	0.07
R5892:Cntnap3	UTSW	13	64799180	missense	probably damaging	1.00
R5950:Cntnap3	UTSW	13	64787769	missense	probably damaging	1.00
R6526:Cntnap3	UTSW	13	64781888	missense	possibly damaging	0.96
R6954:Cntnap3	UTSW	13	64748559	missense	probably benign	0.00
R7138:Cntnap3	UTSW	13	64781725	critical splice donor site	probably null
R7355:Cntnap3	UTSW	13	64771962	missense	probably benign
R7425:Cntnap3	UTSW	13	64758252	missense	probably damaging	1.00
R7521:Cntnap3	UTSW	13	64772001	missense	probably benign	0.22
R7719:Cntnap3	UTSW	13	64772777	nonsense	probably null
R7810:Cntnap3	UTSW	13	64793308	missense	possibly damaging	0.73
R7871:Cntnap3	UTSW	13	64903773	missense	probably benign	0.00
R8415:Cntnap3	UTSW	13	64738665	missense	probably benign	0.31
R8491:Cntnap3	UTSW	13	64785343	missense	probably damaging	1.00
R9086:Cntnap3	UTSW	13	64781759	missense	probably damaging	1.00
R9087:Cntnap3	UTSW	13	64751718	missense	probably damaging	0.96
R9398:Cntnap3	UTSW	13	64903834	missense	probably benign	0.41
R9475:Cntnap3	UTSW	13	64799135	missense	probably damaging	1.00
R9625:Cntnap3	UTSW	13	64858765	missense	probably damaging	1.00
R9679:Cntnap3	UTSW	13	64751748	missense	probably damaging	1.00
Z1176:Cntnap3	UTSW	13	64740872	frame shift	probably null
Z1176:Cntnap3	UTSW	13	64792388	missense	probably damaging	0.98
Z1177:Cntnap3	UTSW	13	64781892	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CGACTCTGAGTTCTCTTGGCTG -3'
(R):5'- GAATCTGTGTGCATCTTTACCAAC -3'

Sequencing Primer
(F):5'- AGGTTTAGGGATCCACGATTACC -3'
(R):5'- ACCAACTCTATCTTTAATGGGGTAG -3'

Posted On

2020-07-28