Incidental Mutation 'R8259:Flnb'
ID640466
Institutional Source Beutler Lab
Gene Symbol Flnb
Ensembl Gene ENSMUSG00000025278
Gene Namefilamin, beta
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8259 (G1)
Quality Score181.009
Status Validated
Chromosome14
Chromosomal Location7817957-7951588 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 7889183 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 511 (Y511C)
Ref Sequence ENSEMBL: ENSMUSP00000052020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052678]
Predicted Effect probably damaging
Transcript: ENSMUST00000052678
AA Change: Y511C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000052020
Gene: ENSMUSG00000025278
AA Change: Y511C

DomainStartEndE-ValueType
CH 18 120 2.38e-26 SMART
CH 141 237 1.83e-18 SMART
IG_FLMN 253 350 1.17e-33 SMART
IG_FLMN 353 449 2.08e-34 SMART
IG_FLMN 451 546 3.42e-35 SMART
IG_FLMN 548 639 6.06e-27 SMART
IG_FLMN 644 739 1.94e-34 SMART
IG_FLMN 741 842 4.25e-31 SMART
IG_FLMN 844 941 5.16e-30 SMART
IG_FLMN 943 1037 5.12e-25 SMART
IG_FLMN 1039 1130 5.31e-41 SMART
IG_FLMN 1132 1225 1.4e-31 SMART
IG_FLMN 1227 1325 1.42e-32 SMART
IG_FLMN 1327 1418 5.19e-35 SMART
IG_FLMN 1420 1514 2.48e-41 SMART
IG_FLMN 1516 1611 3.15e-34 SMART
IG_FLMN 1613 1707 4.99e-37 SMART
IG_FLMN 1730 1819 4.44e-11 SMART
IG_FLMN 1820 1911 5.82e-38 SMART
IG_FLMN 1914 1997 5.68e-9 SMART
IG_FLMN 2001 2092 4.45e-34 SMART
IG_FLMN 2101 2188 1.24e-9 SMART
IG_FLMN 2192 2283 4.48e-39 SMART
IG_FLMN 2286 2378 2.94e-25 SMART
IG_FLMN 2383 2474 5.66e-27 SMART
IG_FLMN 2511 2602 1.63e-27 SMART
Meta Mutation Damage Score 0.8406 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the filamin family. The encoded protein interacts with glycoprotein Ib alpha as part of the process to repair vascular injuries. The platelet glycoprotein Ib complex includes glycoprotein Ib alpha, and it binds the actin cytoskeleton. Mutations in this gene have been found in several conditions: atelosteogenesis type 1 and type 3; boomerang dysplasia; autosomal dominant Larsen syndrome; and spondylocarpotarsal synostosis syndrome. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mutations in this gene cause skeletal defects including runting, premature mineralization, and bone fusion. Nullizygous mice show a delay and reduction in long bone growth. Truncation mutations cause early fusion of spinal vertebrae due to enhanced chondrocyte hypertrophy and early differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,682,481 E1206G probably benign Het
Abca15 A T 7: 120,340,199 H272L probably benign Het
Abcg5 T G 17: 84,676,095 T144P possibly damaging Het
Adam34 G A 8: 43,651,609 S333L probably benign Het
Adcy6 A G 15: 98,601,038 F294S probably damaging Het
Adhfe1 A G 1: 9,558,192 N263S probably null Het
Aebp2 A T 6: 140,637,727 Q309L possibly damaging Het
Akap7 A G 10: 25,171,156 Y281H probably damaging Het
Aplf T C 6: 87,630,005 R476G probably benign Het
Atg2a G A 19: 6,249,829 A588T probably damaging Het
Birc6 A G 17: 74,598,078 T1289A probably benign Het
Cacna1d A G 14: 30,051,518 S1759P probably benign Het
Calcoco1 T C 15: 102,715,793 D236G probably damaging Het
Camsap2 A T 1: 136,280,339 D470E probably benign Het
Capn8 G T 1: 182,565,133 V25L probably benign Het
Card10 A G 15: 78,776,684 V1041A probably damaging Het
Ccr1 T A 9: 123,964,082 H137L probably damaging Het
Cdh23 A T 10: 60,315,656 D2483E probably damaging Het
Chd2 G T 7: 73,435,784 Q1701K probably benign Het
Ckmt2 T A 13: 91,859,216 R286S probably damaging Het
Clhc1 G A 11: 29,553,746 R54Q probably benign Het
Cntnap3 T A 13: 64,787,867 D394V probably damaging Het
Comp A G 8: 70,379,054 D441G probably damaging Het
Cyp20a1 G A 1: 60,352,171 probably null Het
Cyp27a1 A T 1: 74,732,055 D133V probably benign Het
Cyp2a12 C T 7: 27,032,658 Q275* probably null Het
Dnhd1 A T 7: 105,694,788 I1780L probably benign Het
Dpy19l2 A G 9: 24,669,406 V213A probably benign Het
Eml1 A T 12: 108,510,199 I283F probably damaging Het
Ep300 A G 15: 81,639,017 T1281A unknown Het
Ercc6l2 G A 13: 63,872,471 E803K Het
Fat3 A G 9: 15,990,591 V3046A possibly damaging Het
Fbxw20 A G 9: 109,234,695 V3A probably benign Het
Fcgr2b A G 1: 170,968,133 S76P possibly damaging Het
Fgg C T 3: 83,010,170 Q169* probably null Het
Ggt5 G A 10: 75,614,832 V558I probably benign Het
Gm4779 G C X: 101,793,784 T171S possibly damaging Het
Greb1 A T 12: 16,724,924 C157* probably null Het
Grid2ip A G 5: 143,362,589 E145G probably benign Het
Hdac11 T A 6: 91,172,228 V238E probably damaging Het
Herc2 A G 7: 56,205,890 D3858G probably damaging Het
Hoxc4 A G 15: 103,034,739 Y6C probably damaging Het
Incenp A G 19: 9,893,629 L212P unknown Het
Incenp G C 19: 9,893,641 T208R unknown Het
Mctp1 T A 13: 76,801,547 probably null Het
Megf8 T C 7: 25,358,423 M2095T probably benign Het
Mroh2b G A 15: 4,911,909 V308I probably benign Het
Muc1 T A 3: 89,232,034 H580Q probably damaging Het
Naip6 A T 13: 100,316,412 M47K probably benign Het
Nectin3 C T 16: 46,436,391 R419Q probably benign Het
Nlrp4g T G 9: 124,353,392 Y579D noncoding transcript Het
Nrxn1 C A 17: 90,163,821 R1260L probably damaging Het
Nynrin A G 14: 55,863,358 I202V possibly damaging Het
Olfr128 T C 17: 37,923,956 L130P probably damaging Het
Olfr1450 T C 19: 12,954,363 M258T possibly damaging Het
Olfr199 T C 16: 59,216,095 I173V probably benign Het
Olfr78 A G 7: 102,742,827 Y59H probably damaging Het
Pard3 G A 8: 127,371,540 W354* probably null Het
Pcnx3 C T 19: 5,665,384 G1946E probably damaging Het
Peak1 A G 9: 56,259,393 V417A probably damaging Het
Prune2 A G 19: 17,212,308 R3052G unknown Het
Prx T C 7: 27,519,383 L1242P probably damaging Het
Pxylp1 A G 9: 96,825,580 I183T probably benign Het
Ranbp2 A G 10: 58,455,933 E254G probably benign Het
Ren1 C T 1: 133,350,796 R31* probably null Het
Rhot2 C A 17: 25,839,890 R512L probably benign Het
Rpa1 T C 11: 75,302,724 N594D probably benign Het
Rpp14 T G 14: 8,090,526 V150G probably null Het
Rxfp2 T A 5: 150,059,900 I300K probably damaging Het
Sbno1 A T 5: 124,381,696 V1173E probably damaging Het
Scarf1 T A 11: 75,523,863 S486T probably damaging Het
Slc24a4 T C 12: 102,254,669 V455A probably damaging Het
Slitrk1 A G 14: 108,911,221 V686A probably benign Het
Ston2 A T 12: 91,641,680 I882N probably benign Het
Syne2 C A 12: 75,949,369 Q2228K possibly damaging Het
Tcf20 A C 15: 82,852,273 F1659C probably damaging Het
Tenm4 G A 7: 96,867,991 G1430S probably damaging Het
Tlr12 C A 4: 128,617,699 A253S probably benign Het
Tmem87a A G 2: 120,397,447 F73S possibly damaging Het
Trpm1 G A 7: 64,269,029 A1590T probably benign Het
Usp13 C T 3: 32,917,599 Q743* probably null Het
Vmn1r184 T A 7: 26,267,261 M144K probably benign Het
Wee2 A G 6: 40,444,180 D68G probably benign Het
Other mutations in Flnb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Flnb APN 14 7917390 splice site probably benign
IGL01063:Flnb APN 14 7926518 splice site probably benign
IGL01135:Flnb APN 14 7909736 missense probably benign
IGL01139:Flnb APN 14 7945989 missense probably damaging 1.00
IGL01364:Flnb APN 14 7934562 critical splice acceptor site probably null
IGL01417:Flnb APN 14 7905513 missense probably damaging 0.99
IGL01505:Flnb APN 14 7902003 critical splice donor site probably null
IGL01560:Flnb APN 14 7893829 missense probably benign 0.07
IGL01621:Flnb APN 14 7950470 missense probably damaging 1.00
IGL01656:Flnb APN 14 7902010 splice site probably benign
IGL01889:Flnb APN 14 7935967 missense possibly damaging 0.85
IGL01987:Flnb APN 14 7922748 critical splice donor site probably null
IGL02322:Flnb APN 14 7894676 missense probably damaging 1.00
IGL02496:Flnb APN 14 7930919 splice site probably benign
IGL02752:Flnb APN 14 7917338 missense probably benign
IGL03001:Flnb APN 14 7934680 missense probably damaging 0.99
IGL03076:Flnb APN 14 7901988 missense probably benign 0.01
IGL03085:Flnb APN 14 7882211 missense probably benign
IGL03170:Flnb APN 14 7818261 missense possibly damaging 0.90
IGL03373:Flnb APN 14 7890867 critical splice donor site probably null
Boomerang UTSW 14 7901945 missense probably damaging 1.00
Queensland UTSW 14 7927352 missense probably damaging 1.00
R3437_Flnb_252 UTSW 14 7942057 missense probably damaging 0.97
R8441_Flnb_221 UTSW 14 7896488 missense probably benign 0.15
Rhodelinda UTSW 14 7887682 splice site probably benign
saul UTSW 14 7889183 missense probably damaging 0.99
Xerxes UTSW 14 7867551 missense probably damaging 1.00
R0068:Flnb UTSW 14 7915290 missense possibly damaging 0.49
R0068:Flnb UTSW 14 7915290 missense possibly damaging 0.49
R0084:Flnb UTSW 14 7935979 missense probably benign
R0128:Flnb UTSW 14 7901951 missense probably damaging 0.99
R0130:Flnb UTSW 14 7901951 missense probably damaging 0.99
R0148:Flnb UTSW 14 7939077 missense probably benign 0.01
R0166:Flnb UTSW 14 7896115 missense probably damaging 1.00
R0376:Flnb UTSW 14 7946014 critical splice donor site probably null
R0547:Flnb UTSW 14 7912943 splice site probably null
R0612:Flnb UTSW 14 7887682 splice site probably benign
R0656:Flnb UTSW 14 7927352 missense probably damaging 1.00
R0691:Flnb UTSW 14 7890810 missense probably benign 0.16
R1241:Flnb UTSW 14 7896503 missense probably benign 0.06
R1572:Flnb UTSW 14 7883908 missense probably damaging 0.97
R1682:Flnb UTSW 14 7913121 missense probably benign 0.04
R1807:Flnb UTSW 14 7934645 missense probably benign 0.26
R1848:Flnb UTSW 14 7892113 missense probably damaging 1.00
R1959:Flnb UTSW 14 7884735 nonsense probably null
R2078:Flnb UTSW 14 7927466 missense probably damaging 1.00
R2132:Flnb UTSW 14 7873376 missense probably benign 0.04
R2209:Flnb UTSW 14 7905507 nonsense probably null
R2212:Flnb UTSW 14 7881652 small deletion probably benign
R2213:Flnb UTSW 14 7881652 small deletion probably benign
R2363:Flnb UTSW 14 7945950 missense possibly damaging 0.95
R2415:Flnb UTSW 14 7929932 missense probably benign 0.07
R2983:Flnb UTSW 14 7882250 missense probably damaging 1.00
R3001:Flnb UTSW 14 7907162 missense probably benign 0.22
R3002:Flnb UTSW 14 7907162 missense probably benign 0.22
R3436:Flnb UTSW 14 7942057 missense probably damaging 0.97
R3437:Flnb UTSW 14 7942057 missense probably damaging 0.97
R3778:Flnb UTSW 14 7915353 missense probably benign 0.06
R3783:Flnb UTSW 14 7889236 missense probably benign 0.04
R4162:Flnb UTSW 14 7915374 missense possibly damaging 0.81
R4163:Flnb UTSW 14 7915374 missense possibly damaging 0.81
R4164:Flnb UTSW 14 7915374 missense possibly damaging 0.81
R4356:Flnb UTSW 14 7922700 missense probably benign
R4369:Flnb UTSW 14 7942216 missense probably benign
R4783:Flnb UTSW 14 7905701 missense probably benign 0.12
R4785:Flnb UTSW 14 7905701 missense probably benign 0.12
R4790:Flnb UTSW 14 7905661 missense probably benign 0.34
R4828:Flnb UTSW 14 7919238 missense probably benign 0.13
R4882:Flnb UTSW 14 7929936 missense possibly damaging 0.56
R5002:Flnb UTSW 14 7945882 missense probably damaging 1.00
R5058:Flnb UTSW 14 7924262 nonsense probably null
R5184:Flnb UTSW 14 7901945 missense probably damaging 1.00
R5186:Flnb UTSW 14 7909748 missense probably damaging 1.00
R5395:Flnb UTSW 14 7883881 missense probably benign 0.02
R5421:Flnb UTSW 14 7926494 missense probably damaging 1.00
R5667:Flnb UTSW 14 7890843 missense probably benign 0.00
R5671:Flnb UTSW 14 7890843 missense probably benign 0.00
R5714:Flnb UTSW 14 7929073 missense probably damaging 1.00
R5860:Flnb UTSW 14 7931135 missense probably damaging 1.00
R5892:Flnb UTSW 14 7907183 missense probably damaging 1.00
R5924:Flnb UTSW 14 7890765 missense probably benign 0.00
R6131:Flnb UTSW 14 7894635 missense possibly damaging 0.79
R6244:Flnb UTSW 14 7892092 missense probably damaging 1.00
R6489:Flnb UTSW 14 7867551 missense probably damaging 1.00
R6582:Flnb UTSW 14 7892275 critical splice donor site probably null
R6586:Flnb UTSW 14 7929138 missense possibly damaging 0.93
R6611:Flnb UTSW 14 7915318 missense probably damaging 1.00
R6626:Flnb UTSW 14 7929012 missense probably damaging 1.00
R6700:Flnb UTSW 14 7892189 missense probably damaging 0.99
R6738:Flnb UTSW 14 7904536 missense probably benign 0.01
R6864:Flnb UTSW 14 7905640 missense possibly damaging 0.84
R6916:Flnb UTSW 14 7907171 missense probably damaging 0.99
R7117:Flnb UTSW 14 7894214 missense probably benign 0.02
R7164:Flnb UTSW 14 7915944 splice site probably null
R7328:Flnb UTSW 14 7883788 missense possibly damaging 0.95
R7328:Flnb UTSW 14 7894660 nonsense probably null
R7687:Flnb UTSW 14 7924224 missense probably damaging 1.00
R7716:Flnb UTSW 14 7917274 missense possibly damaging 0.64
R7763:Flnb UTSW 14 7926478 missense probably benign 0.00
R7821:Flnb UTSW 14 7939113 missense probably benign 0.00
R7921:Flnb UTSW 14 7933800 missense possibly damaging 0.57
R8008:Flnb UTSW 14 7892155 missense probably damaging 1.00
R8075:Flnb UTSW 14 7913048 missense probably benign 0.00
R8084:Flnb UTSW 14 7907243 missense probably benign 0.00
R8441:Flnb UTSW 14 7896488 missense probably benign 0.15
R8493:Flnb UTSW 14 7869822 missense probably damaging 0.97
R8508:Flnb UTSW 14 7950394 missense probably damaging 0.98
R8531:Flnb UTSW 14 7929939 missense probably damaging 1.00
R8812:Flnb UTSW 14 7887624 missense probably benign 0.06
R8814:Flnb UTSW 14 7927409 missense probably damaging 1.00
R8825:Flnb UTSW 14 7887566 missense probably damaging 1.00
R8868:Flnb UTSW 14 7908671 missense probably benign 0.02
R8955:Flnb UTSW 14 7892874 missense probably damaging 1.00
R8955:Flnb UTSW 14 7904688 nonsense probably null
X0066:Flnb UTSW 14 7908636 missense probably damaging 1.00
Z1088:Flnb UTSW 14 7905871 missense probably benign 0.04
Z1176:Flnb UTSW 14 7942066 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- CCCAGCTTTTGAGGGAGATTTC -3'
(R):5'- TGCTGTTCTGAAAAGGCGG -3'

Sequencing Primer
(F):5'- TGAGGGAGATTTCACATTCAGAGTC -3'
(R):5'- AACAAAGCAGATCTCTCTTCCCTCTG -3'
Posted On2020-07-28