Incidental Mutation 'R8259:Flnb'
ID 640466
Institutional Source Beutler Lab
Gene Symbol Flnb
Ensembl Gene ENSMUSG00000025278
Gene Name filamin, beta
Synonyms
MMRRC Submission 067650-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8259 (G1)
Quality Score 181.009
Status Validated
Chromosome 14
Chromosomal Location 14518185-14651816 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 7889183 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 511 (Y511C)
Ref Sequence ENSEMBL: ENSMUSP00000052020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052678]
AlphaFold Q80X90
Predicted Effect probably damaging
Transcript: ENSMUST00000052678
AA Change: Y511C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000052020
Gene: ENSMUSG00000025278
AA Change: Y511C

DomainStartEndE-ValueType
CH 18 120 2.38e-26 SMART
CH 141 237 1.83e-18 SMART
IG_FLMN 253 350 1.17e-33 SMART
IG_FLMN 353 449 2.08e-34 SMART
IG_FLMN 451 546 3.42e-35 SMART
IG_FLMN 548 639 6.06e-27 SMART
IG_FLMN 644 739 1.94e-34 SMART
IG_FLMN 741 842 4.25e-31 SMART
IG_FLMN 844 941 5.16e-30 SMART
IG_FLMN 943 1037 5.12e-25 SMART
IG_FLMN 1039 1130 5.31e-41 SMART
IG_FLMN 1132 1225 1.4e-31 SMART
IG_FLMN 1227 1325 1.42e-32 SMART
IG_FLMN 1327 1418 5.19e-35 SMART
IG_FLMN 1420 1514 2.48e-41 SMART
IG_FLMN 1516 1611 3.15e-34 SMART
IG_FLMN 1613 1707 4.99e-37 SMART
IG_FLMN 1730 1819 4.44e-11 SMART
IG_FLMN 1820 1911 5.82e-38 SMART
IG_FLMN 1914 1997 5.68e-9 SMART
IG_FLMN 2001 2092 4.45e-34 SMART
IG_FLMN 2101 2188 1.24e-9 SMART
IG_FLMN 2192 2283 4.48e-39 SMART
IG_FLMN 2286 2378 2.94e-25 SMART
IG_FLMN 2383 2474 5.66e-27 SMART
IG_FLMN 2511 2602 1.63e-27 SMART
Meta Mutation Damage Score 0.8406 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the filamin family. The encoded protein interacts with glycoprotein Ib alpha as part of the process to repair vascular injuries. The platelet glycoprotein Ib complex includes glycoprotein Ib alpha, and it binds the actin cytoskeleton. Mutations in this gene have been found in several conditions: atelosteogenesis type 1 and type 3; boomerang dysplasia; autosomal dominant Larsen syndrome; and spondylocarpotarsal synostosis syndrome. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mutations in this gene cause skeletal defects including runting, premature mineralization, and bone fusion. Nullizygous mice show a delay and reduction in long bone growth. Truncation mutations cause early fusion of spinal vertebrae due to enhanced chondrocyte hypertrophy and early differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A T 7: 119,939,422 (GRCm39) H272L probably benign Het
Abcg5 T G 17: 84,983,523 (GRCm39) T144P possibly damaging Het
Adam34 G A 8: 44,104,646 (GRCm39) S333L probably benign Het
Adcy6 A G 15: 98,498,919 (GRCm39) F294S probably damaging Het
Adhfe1 A G 1: 9,628,417 (GRCm39) N263S probably null Het
Aebp2 A T 6: 140,583,453 (GRCm39) Q309L possibly damaging Het
Akap7 A G 10: 25,047,054 (GRCm39) Y281H probably damaging Het
Aplf T C 6: 87,606,987 (GRCm39) R476G probably benign Het
Atg2a G A 19: 6,299,859 (GRCm39) A588T probably damaging Het
Birc6 A G 17: 74,905,073 (GRCm39) T1289A probably benign Het
Cacna1d A G 14: 29,773,475 (GRCm39) S1759P probably benign Het
Calcoco1 T C 15: 102,624,228 (GRCm39) D236G probably damaging Het
Camsap2 A T 1: 136,208,077 (GRCm39) D470E probably benign Het
Capn8 G T 1: 182,392,698 (GRCm39) V25L probably benign Het
Card10 A G 15: 78,660,884 (GRCm39) V1041A probably damaging Het
Ccr1 T A 9: 123,764,119 (GRCm39) H137L probably damaging Het
Cdh23 A T 10: 60,151,435 (GRCm39) D2483E probably damaging Het
Chd2 G T 7: 73,085,532 (GRCm39) Q1701K probably benign Het
Ckmt2 T A 13: 92,007,335 (GRCm39) R286S probably damaging Het
Clhc1 G A 11: 29,503,746 (GRCm39) R54Q probably benign Het
Cntnap3 T A 13: 64,935,681 (GRCm39) D394V probably damaging Het
Comp A G 8: 70,831,704 (GRCm39) D441G probably damaging Het
Cyp20a1 G A 1: 60,391,330 (GRCm39) probably null Het
Cyp27a1 A T 1: 74,771,214 (GRCm39) D133V probably benign Het
Cyp2a12 C T 7: 26,732,083 (GRCm39) Q275* probably null Het
Dnhd1 A T 7: 105,343,995 (GRCm39) I1780L probably benign Het
Dpy19l2 A G 9: 24,580,702 (GRCm39) V213A probably benign Het
Eml1 A T 12: 108,476,458 (GRCm39) I283F probably damaging Het
Ep300 A G 15: 81,523,218 (GRCm39) T1281A unknown Het
Ercc6l2 G A 13: 64,020,285 (GRCm39) E803K Het
Fat3 A G 9: 15,901,887 (GRCm39) V3046A possibly damaging Het
Fbxw20 A G 9: 109,063,763 (GRCm39) V3A probably benign Het
Fcgr2b A G 1: 170,795,702 (GRCm39) S76P possibly damaging Het
Fgg C T 3: 82,917,477 (GRCm39) Q169* probably null Het
Ggt5 G A 10: 75,450,666 (GRCm39) V558I probably benign Het
Gm4779 G C X: 100,837,390 (GRCm39) T171S possibly damaging Het
Greb1 A T 12: 16,774,925 (GRCm39) C157* probably null Het
Grid2ip A G 5: 143,348,344 (GRCm39) E145G probably benign Het
Hdac11 T A 6: 91,149,210 (GRCm39) V238E probably damaging Het
Herc2 A G 7: 55,855,638 (GRCm39) D3858G probably damaging Het
Hoxc4 A G 15: 102,943,165 (GRCm39) Y6C probably damaging Het
Incenp A G 19: 9,870,993 (GRCm39) L212P unknown Het
Incenp G C 19: 9,871,005 (GRCm39) T208R unknown Het
Mctp1 T A 13: 76,949,666 (GRCm39) probably null Het
Megf8 T C 7: 25,057,848 (GRCm39) M2095T probably benign Het
Mroh2b G A 15: 4,941,391 (GRCm39) V308I probably benign Het
Muc1 T A 3: 89,139,341 (GRCm39) H580Q probably damaging Het
Naip6 A T 13: 100,452,920 (GRCm39) M47K probably benign Het
Nectin3 C T 16: 46,256,754 (GRCm39) R419Q probably benign Het
Nlrp4g T G 9: 124,353,392 (GRCm38) Y579D noncoding transcript Het
Nrxn1 C A 17: 90,471,249 (GRCm39) R1260L probably damaging Het
Nynrin A G 14: 56,100,815 (GRCm39) I202V possibly damaging Het
Or14j7 T C 17: 38,234,847 (GRCm39) L130P probably damaging Het
Or51e2 A G 7: 102,392,034 (GRCm39) Y59H probably damaging Het
Or5ac17 T C 16: 59,036,458 (GRCm39) I173V probably benign Het
Or5b98 T C 19: 12,931,727 (GRCm39) M258T possibly damaging Het
Pard3 G A 8: 128,098,021 (GRCm39) W354* probably null Het
Pcnx3 C T 19: 5,715,412 (GRCm39) G1946E probably damaging Het
Peak1 A G 9: 56,166,677 (GRCm39) V417A probably damaging Het
Prune2 A G 19: 17,189,672 (GRCm39) R3052G unknown Het
Prx T C 7: 27,218,808 (GRCm39) L1242P probably damaging Het
Pxylp1 A G 9: 96,707,633 (GRCm39) I183T probably benign Het
Ranbp2 A G 10: 58,291,755 (GRCm39) E254G probably benign Het
Ren1 C T 1: 133,278,534 (GRCm39) R31* probably null Het
Rhot2 C A 17: 26,058,864 (GRCm39) R512L probably benign Het
Rpa1 T C 11: 75,193,550 (GRCm39) N594D probably benign Het
Rpp14 T G 14: 8,090,526 (GRCm38) V150G probably null Het
Rxfp2 T A 5: 149,983,365 (GRCm39) I300K probably damaging Het
Sbno1 A T 5: 124,519,759 (GRCm39) V1173E probably damaging Het
Scarf1 T A 11: 75,414,689 (GRCm39) S486T probably damaging Het
Slc24a4 T C 12: 102,220,928 (GRCm39) V455A probably damaging Het
Slitrk1 A G 14: 109,148,653 (GRCm39) V686A probably benign Het
Spata31e2 T C 1: 26,721,562 (GRCm39) E1206G probably benign Het
Ston2 A T 12: 91,608,454 (GRCm39) I882N probably benign Het
Syne2 C A 12: 75,996,143 (GRCm39) Q2228K possibly damaging Het
Tcf20 A C 15: 82,736,474 (GRCm39) F1659C probably damaging Het
Tenm4 G A 7: 96,517,198 (GRCm39) G1430S probably damaging Het
Tlr12 C A 4: 128,511,492 (GRCm39) A253S probably benign Het
Tmem87a A G 2: 120,227,928 (GRCm39) F73S possibly damaging Het
Trpm1 G A 7: 63,918,777 (GRCm39) A1590T probably benign Het
Usp13 C T 3: 32,971,748 (GRCm39) Q743* probably null Het
Vmn1r184 T A 7: 25,966,686 (GRCm39) M144K probably benign Het
Wee2 A G 6: 40,421,114 (GRCm39) D68G probably benign Het
Other mutations in Flnb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Flnb APN 14 7,917,390 (GRCm38) splice site probably benign
IGL01063:Flnb APN 14 7,926,518 (GRCm38) splice site probably benign
IGL01135:Flnb APN 14 7,909,736 (GRCm38) missense probably benign
IGL01139:Flnb APN 14 7,945,989 (GRCm38) missense probably damaging 1.00
IGL01364:Flnb APN 14 7,934,562 (GRCm38) critical splice acceptor site probably null
IGL01417:Flnb APN 14 7,905,513 (GRCm38) missense probably damaging 0.99
IGL01505:Flnb APN 14 7,902,003 (GRCm38) critical splice donor site probably null
IGL01560:Flnb APN 14 7,893,829 (GRCm38) missense probably benign 0.07
IGL01621:Flnb APN 14 7,950,470 (GRCm38) missense probably damaging 1.00
IGL01656:Flnb APN 14 7,902,010 (GRCm38) splice site probably benign
IGL01889:Flnb APN 14 7,935,967 (GRCm38) missense possibly damaging 0.85
IGL01987:Flnb APN 14 7,922,748 (GRCm38) critical splice donor site probably null
IGL02322:Flnb APN 14 7,894,676 (GRCm38) missense probably damaging 1.00
IGL02496:Flnb APN 14 7,930,919 (GRCm38) splice site probably benign
IGL02752:Flnb APN 14 7,917,338 (GRCm38) missense probably benign
IGL03001:Flnb APN 14 7,934,680 (GRCm38) missense probably damaging 0.99
IGL03076:Flnb APN 14 7,901,988 (GRCm38) missense probably benign 0.01
IGL03085:Flnb APN 14 7,882,211 (GRCm38) missense probably benign
IGL03170:Flnb APN 14 7,818,261 (GRCm38) missense possibly damaging 0.90
IGL03373:Flnb APN 14 7,890,867 (GRCm38) critical splice donor site probably null
Boomerang UTSW 14 7,901,945 (GRCm38) missense probably damaging 1.00
Queensland UTSW 14 7,927,352 (GRCm38) missense probably damaging 1.00
R3437_Flnb_252 UTSW 14 7,942,057 (GRCm38) missense probably damaging 0.97
R8441_Flnb_221 UTSW 14 7,896,488 (GRCm38) missense probably benign 0.15
Rhodelinda UTSW 14 7,887,682 (GRCm38) splice site probably benign
saul UTSW 14 7,889,183 (GRCm38) missense probably damaging 0.99
Xerxes UTSW 14 7,867,551 (GRCm38) missense probably damaging 1.00
R0068:Flnb UTSW 14 7,915,290 (GRCm38) missense possibly damaging 0.49
R0068:Flnb UTSW 14 7,915,290 (GRCm38) missense possibly damaging 0.49
R0084:Flnb UTSW 14 7,935,979 (GRCm38) missense probably benign
R0128:Flnb UTSW 14 7,901,951 (GRCm38) missense probably damaging 0.99
R0130:Flnb UTSW 14 7,901,951 (GRCm38) missense probably damaging 0.99
R0148:Flnb UTSW 14 7,939,077 (GRCm38) missense probably benign 0.01
R0166:Flnb UTSW 14 7,896,115 (GRCm38) missense probably damaging 1.00
R0376:Flnb UTSW 14 7,946,014 (GRCm38) critical splice donor site probably null
R0547:Flnb UTSW 14 7,912,943 (GRCm38) splice site probably null
R0612:Flnb UTSW 14 7,887,682 (GRCm38) splice site probably benign
R0656:Flnb UTSW 14 7,927,352 (GRCm38) missense probably damaging 1.00
R0691:Flnb UTSW 14 7,890,810 (GRCm38) missense probably benign 0.16
R1241:Flnb UTSW 14 7,896,503 (GRCm38) missense probably benign 0.06
R1572:Flnb UTSW 14 7,883,908 (GRCm38) missense probably damaging 0.97
R1682:Flnb UTSW 14 7,913,121 (GRCm38) missense probably benign 0.04
R1807:Flnb UTSW 14 7,934,645 (GRCm38) missense probably benign 0.26
R1848:Flnb UTSW 14 7,892,113 (GRCm38) missense probably damaging 1.00
R1959:Flnb UTSW 14 7,884,735 (GRCm38) nonsense probably null
R2078:Flnb UTSW 14 7,927,466 (GRCm38) missense probably damaging 1.00
R2132:Flnb UTSW 14 7,873,376 (GRCm38) missense probably benign 0.04
R2209:Flnb UTSW 14 7,905,507 (GRCm38) nonsense probably null
R2212:Flnb UTSW 14 7,881,652 (GRCm38) small deletion probably benign
R2213:Flnb UTSW 14 7,881,652 (GRCm38) small deletion probably benign
R2363:Flnb UTSW 14 7,945,950 (GRCm38) missense possibly damaging 0.95
R2415:Flnb UTSW 14 7,929,932 (GRCm38) missense probably benign 0.07
R2983:Flnb UTSW 14 7,882,250 (GRCm38) missense probably damaging 1.00
R3001:Flnb UTSW 14 7,907,162 (GRCm38) missense probably benign 0.22
R3002:Flnb UTSW 14 7,907,162 (GRCm38) missense probably benign 0.22
R3436:Flnb UTSW 14 7,942,057 (GRCm38) missense probably damaging 0.97
R3437:Flnb UTSW 14 7,942,057 (GRCm38) missense probably damaging 0.97
R3778:Flnb UTSW 14 7,915,353 (GRCm38) missense probably benign 0.06
R3783:Flnb UTSW 14 7,889,236 (GRCm38) missense probably benign 0.04
R4162:Flnb UTSW 14 7,915,374 (GRCm38) missense possibly damaging 0.81
R4163:Flnb UTSW 14 7,915,374 (GRCm38) missense possibly damaging 0.81
R4164:Flnb UTSW 14 7,915,374 (GRCm38) missense possibly damaging 0.81
R4356:Flnb UTSW 14 7,922,700 (GRCm38) missense probably benign
R4369:Flnb UTSW 14 7,942,216 (GRCm38) missense probably benign
R4783:Flnb UTSW 14 7,905,701 (GRCm38) missense probably benign 0.12
R4785:Flnb UTSW 14 7,905,701 (GRCm38) missense probably benign 0.12
R4790:Flnb UTSW 14 7,905,661 (GRCm38) missense probably benign 0.34
R4828:Flnb UTSW 14 7,919,238 (GRCm38) missense probably benign 0.13
R4882:Flnb UTSW 14 7,929,936 (GRCm38) missense possibly damaging 0.56
R5002:Flnb UTSW 14 7,945,882 (GRCm38) missense probably damaging 1.00
R5058:Flnb UTSW 14 7,924,262 (GRCm38) nonsense probably null
R5184:Flnb UTSW 14 7,901,945 (GRCm38) missense probably damaging 1.00
R5186:Flnb UTSW 14 7,909,748 (GRCm38) missense probably damaging 1.00
R5395:Flnb UTSW 14 7,883,881 (GRCm38) missense probably benign 0.02
R5421:Flnb UTSW 14 7,926,494 (GRCm38) missense probably damaging 1.00
R5667:Flnb UTSW 14 7,890,843 (GRCm38) missense probably benign 0.00
R5671:Flnb UTSW 14 7,890,843 (GRCm38) missense probably benign 0.00
R5714:Flnb UTSW 14 7,929,073 (GRCm38) missense probably damaging 1.00
R5860:Flnb UTSW 14 7,931,135 (GRCm38) missense probably damaging 1.00
R5892:Flnb UTSW 14 7,907,183 (GRCm38) missense probably damaging 1.00
R5924:Flnb UTSW 14 7,890,765 (GRCm38) missense probably benign 0.00
R6131:Flnb UTSW 14 7,894,635 (GRCm38) missense possibly damaging 0.79
R6244:Flnb UTSW 14 7,892,092 (GRCm38) missense probably damaging 1.00
R6489:Flnb UTSW 14 7,867,551 (GRCm38) missense probably damaging 1.00
R6582:Flnb UTSW 14 7,892,275 (GRCm38) critical splice donor site probably null
R6586:Flnb UTSW 14 7,929,138 (GRCm38) missense possibly damaging 0.93
R6611:Flnb UTSW 14 7,915,318 (GRCm38) missense probably damaging 1.00
R6626:Flnb UTSW 14 7,929,012 (GRCm38) missense probably damaging 1.00
R6700:Flnb UTSW 14 7,892,189 (GRCm38) missense probably damaging 0.99
R6738:Flnb UTSW 14 7,904,536 (GRCm38) missense probably benign 0.01
R6864:Flnb UTSW 14 7,905,640 (GRCm38) missense possibly damaging 0.84
R6916:Flnb UTSW 14 7,907,171 (GRCm38) missense probably damaging 0.99
R7117:Flnb UTSW 14 7,894,214 (GRCm38) missense probably benign 0.02
R7164:Flnb UTSW 14 7,915,944 (GRCm38) splice site probably null
R7328:Flnb UTSW 14 7,894,660 (GRCm38) nonsense probably null
R7328:Flnb UTSW 14 7,883,788 (GRCm38) missense possibly damaging 0.95
R7687:Flnb UTSW 14 7,924,224 (GRCm38) missense probably damaging 1.00
R7716:Flnb UTSW 14 7,917,274 (GRCm38) missense possibly damaging 0.64
R7763:Flnb UTSW 14 7,926,478 (GRCm38) missense probably benign 0.00
R7821:Flnb UTSW 14 7,939,113 (GRCm38) missense probably benign 0.00
R7921:Flnb UTSW 14 7,933,800 (GRCm38) missense possibly damaging 0.57
R8008:Flnb UTSW 14 7,892,155 (GRCm38) missense probably damaging 1.00
R8075:Flnb UTSW 14 7,913,048 (GRCm38) missense probably benign 0.00
R8084:Flnb UTSW 14 7,907,243 (GRCm38) missense probably benign 0.00
R8441:Flnb UTSW 14 7,896,488 (GRCm38) missense probably benign 0.15
R8493:Flnb UTSW 14 7,869,822 (GRCm38) missense probably damaging 0.97
R8508:Flnb UTSW 14 7,950,394 (GRCm38) missense probably damaging 0.98
R8531:Flnb UTSW 14 7,929,939 (GRCm38) missense probably damaging 1.00
R8812:Flnb UTSW 14 7,887,624 (GRCm38) missense probably benign 0.06
R8814:Flnb UTSW 14 7,927,409 (GRCm38) missense probably damaging 1.00
R8825:Flnb UTSW 14 7,887,566 (GRCm38) missense probably damaging 1.00
R8868:Flnb UTSW 14 7,908,671 (GRCm38) missense probably benign 0.02
R8955:Flnb UTSW 14 7,904,688 (GRCm38) nonsense probably null
R8955:Flnb UTSW 14 7,892,874 (GRCm38) missense probably damaging 1.00
R8976:Flnb UTSW 14 7,901,882 (GRCm38) critical splice acceptor site probably null
R9055:Flnb UTSW 14 7,908,553 (GRCm38) missense probably benign 0.00
R9148:Flnb UTSW 14 7,817,996 (GRCm38) start gained probably benign
R9179:Flnb UTSW 14 7,887,541 (GRCm38) nonsense probably null
R9180:Flnb UTSW 14 7,818,219 (GRCm38) missense probably damaging 1.00
R9189:Flnb UTSW 14 7,892,976 (GRCm38) missense possibly damaging 0.90
R9286:Flnb UTSW 14 7,873,414 (GRCm38) missense probably damaging 0.98
R9288:Flnb UTSW 14 7,904,498 (GRCm38) missense probably benign 0.43
R9354:Flnb UTSW 14 7,818,411 (GRCm38) missense probably benign 0.13
R9484:Flnb UTSW 14 7,929,004 (GRCm38) missense probably benign 0.06
R9505:Flnb UTSW 14 7,904,665 (GRCm38) missense probably benign
R9525:Flnb UTSW 14 7,905,481 (GRCm38) missense probably damaging 1.00
R9621:Flnb UTSW 14 7,926,421 (GRCm38) missense probably damaging 0.99
R9630:Flnb UTSW 14 7,926,438 (GRCm38) nonsense probably null
R9739:Flnb UTSW 14 7,935,954 (GRCm38) nonsense probably null
R9760:Flnb UTSW 14 7,929,846 (GRCm38) missense probably damaging 0.98
X0066:Flnb UTSW 14 7,908,636 (GRCm38) missense probably damaging 1.00
Z1088:Flnb UTSW 14 7,905,871 (GRCm38) missense probably benign 0.04
Z1176:Flnb UTSW 14 7,942,066 (GRCm38) missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- CCCAGCTTTTGAGGGAGATTTC -3'
(R):5'- TGCTGTTCTGAAAAGGCGG -3'

Sequencing Primer
(F):5'- TGAGGGAGATTTCACATTCAGAGTC -3'
(R):5'- AACAAAGCAGATCTCTCTTCCCTCTG -3'
Posted On 2020-07-28