Incidental Mutation 'R8259:Rpp14'
ID640467
Institutional Source Beutler Lab
Gene Symbol Rpp14
Ensembl Gene ENSMUSG00000023156
Gene Nameribonuclease P 14 subunit
Synonyms2610511E03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.933) question?
Stock #R8259 (G1)
Quality Score206.009
Status Not validated
Chromosome14
Chromosomal Location8080367-8091834 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 8090526 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 150 (V150G)
Ref Sequence ENSEMBL: ENSMUSP00000136494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023924] [ENSMUST00000180369]
Predicted Effect probably benign
Transcript: ENSMUST00000023924
SMART Domains Protein: ENSMUSP00000023924
Gene: ENSMUSG00000023156

DomainStartEndE-ValueType
Pfam:RNase_P_Rpp14 8 109 1.8e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000180369
AA Change: V150G

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000136494
Gene: ENSMUSG00000023156
AA Change: V150G

DomainStartEndE-ValueType
Pfam:MaoC_dehydratas 22 142 2e-21 PFAM
Pfam:MaoC_dehydrat_N 26 148 6.4e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,682,481 E1206G probably benign Het
Abca15 A T 7: 120,340,199 H272L probably benign Het
Abcg5 T G 17: 84,676,095 T144P possibly damaging Het
Adam34 G A 8: 43,651,609 S333L probably benign Het
Adcy6 A G 15: 98,601,038 F294S probably damaging Het
Adhfe1 A G 1: 9,558,192 N263S probably null Het
Aebp2 A T 6: 140,637,727 Q309L possibly damaging Het
Akap7 A G 10: 25,171,156 Y281H probably damaging Het
Aplf T C 6: 87,630,005 R476G probably benign Het
Atg2a G A 19: 6,249,829 A588T probably damaging Het
Birc6 A G 17: 74,598,078 T1289A probably benign Het
Cacna1d A G 14: 30,051,518 S1759P probably benign Het
Calcoco1 T C 15: 102,715,793 D236G probably damaging Het
Camsap2 A T 1: 136,280,339 D470E probably benign Het
Capn8 G T 1: 182,565,133 V25L probably benign Het
Card10 A G 15: 78,776,684 V1041A probably damaging Het
Ccr1 T A 9: 123,964,082 H137L probably damaging Het
Cdh23 A T 10: 60,315,656 D2483E probably damaging Het
Chd2 G T 7: 73,435,784 Q1701K probably benign Het
Ckmt2 T A 13: 91,859,216 R286S probably damaging Het
Clhc1 G A 11: 29,553,746 R54Q probably benign Het
Cntnap3 T A 13: 64,787,867 D394V probably damaging Het
Comp A G 8: 70,379,054 D441G probably damaging Het
Cyp27a1 A T 1: 74,732,055 D133V probably benign Het
Cyp2a12 C T 7: 27,032,658 Q275* probably null Het
Dpy19l2 A G 9: 24,669,406 V213A probably benign Het
Eml1 A T 12: 108,510,199 I283F probably damaging Het
Ep300 A G 15: 81,639,017 T1281A unknown Het
Ercc6l2 G A 13: 63,872,471 E803K Het
Fat3 A G 9: 15,990,591 V3046A possibly damaging Het
Fbxw20 A G 9: 109,234,695 V3A probably benign Het
Fcgr2b A G 1: 170,968,133 S76P possibly damaging Het
Fgg C T 3: 83,010,170 Q169* probably null Het
Flnb A G 14: 7,889,183 Y511C probably damaging Het
Ggt5 G A 10: 75,614,832 V558I probably benign Het
Gm4779 G C X: 101,793,784 T171S possibly damaging Het
Greb1 A T 12: 16,724,924 C157* probably null Het
Grid2ip A G 5: 143,362,589 E145G probably benign Het
Hdac11 T A 6: 91,172,228 V238E probably damaging Het
Herc2 A G 7: 56,205,890 D3858G probably damaging Het
Hoxc4 A G 15: 103,034,739 Y6C probably damaging Het
Incenp A G 19: 9,893,629 L212P unknown Het
Incenp G C 19: 9,893,641 T208R unknown Het
Mctp1 T A 13: 76,801,547 probably null Het
Megf8 T C 7: 25,358,423 M2095T probably benign Het
Mroh2b G A 15: 4,911,909 V308I probably benign Het
Muc1 T A 3: 89,232,034 H580Q probably damaging Het
Naip6 A T 13: 100,316,412 M47K probably benign Het
Nectin3 C T 16: 46,436,391 R419Q probably benign Het
Nlrp4g T G 9: 124,353,392 Y579D noncoding transcript Het
Nrxn1 C A 17: 90,163,821 R1260L probably damaging Het
Nynrin A G 14: 55,863,358 I202V possibly damaging Het
Olfr128 T C 17: 37,923,956 L130P probably damaging Het
Olfr1450 T C 19: 12,954,363 M258T possibly damaging Het
Olfr199 T C 16: 59,216,095 I173V probably benign Het
Olfr78 A G 7: 102,742,827 Y59H probably damaging Het
Pard3 G A 8: 127,371,540 W354* probably null Het
Pcnx3 C T 19: 5,665,384 G1946E probably damaging Het
Peak1 A G 9: 56,259,393 V417A probably damaging Het
Prune2 A G 19: 17,212,308 R3052G unknown Het
Prx T C 7: 27,519,383 L1242P probably damaging Het
Pxylp1 A G 9: 96,825,580 I183T probably benign Het
Ranbp2 A G 10: 58,455,933 E254G probably benign Het
Ren1 C T 1: 133,350,796 R31* probably null Het
Rhot2 C A 17: 25,839,890 R512L probably benign Het
Rpa1 T C 11: 75,302,724 N594D probably benign Het
Rxfp2 T A 5: 150,059,900 I300K probably damaging Het
Sbno1 A T 5: 124,381,696 V1173E probably damaging Het
Scarf1 T A 11: 75,523,863 S486T probably damaging Het
Slc24a4 T C 12: 102,254,669 V455A probably damaging Het
Slitrk1 A G 14: 108,911,221 V686A probably benign Het
Ston2 A T 12: 91,641,680 I882N probably benign Het
Syne2 C A 12: 75,949,369 Q2228K possibly damaging Het
Tcf20 A C 15: 82,852,273 F1659C probably damaging Het
Tenm4 G A 7: 96,867,991 G1430S probably damaging Het
Tlr12 C A 4: 128,617,699 A253S probably benign Het
Tmem87a A G 2: 120,397,447 F73S possibly damaging Het
Trpm1 G A 7: 64,269,029 A1590T probably benign Het
Usp13 C T 3: 32,917,599 Q743* probably null Het
Vmn1r184 T A 7: 26,267,261 M144K probably benign Het
Wee2 A G 6: 40,444,180 D68G probably benign Het
Other mutations in Rpp14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Rpp14 APN 14 8083934 missense possibly damaging 0.78
IGL00424:Rpp14 APN 14 8083934 missense possibly damaging 0.78
IGL00478:Rpp14 APN 14 8083934 missense possibly damaging 0.78
IGL00538:Rpp14 APN 14 8083934 missense possibly damaging 0.78
R1167:Rpp14 UTSW 14 8083705 splice site probably null
R1499:Rpp14 UTSW 14 8090528 missense probably benign 0.18
R1874:Rpp14 UTSW 14 8090145 missense probably benign
R4778:Rpp14 UTSW 14 8090203 missense probably benign 0.08
R5222:Rpp14 UTSW 14 8087513 missense probably damaging 0.96
R5561:Rpp14 UTSW 14 8090558 splice site probably null
R6015:Rpp14 UTSW 14 8090462 missense probably benign 0.00
R6801:Rpp14 UTSW 14 8083717 start gained probably benign
R7643:Rpp14 UTSW 14 8090325 nonsense probably null
R7685:Rpp14 UTSW 14 8090453 missense probably damaging 0.98
R7872:Rpp14 UTSW 14 8083724 start codon destroyed probably null 0.00
Z1088:Rpp14 UTSW 14 8090539 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGGAAAGACAATTGTTCACGG -3'
(R):5'- CACCAATCTGGAAGTCTCCC -3'

Sequencing Primer
(F):5'- AAATGGACTTATTTCAGCTCTCCTGG -3'
(R):5'- CCTTCCACACACAGCTTCTGG -3'
Posted On2020-07-28