Incidental Mutation 'R8259:Mroh2b'
ID640471
Institutional Source Beutler Lab
Gene Symbol Mroh2b
Ensembl Gene ENSMUSG00000022155
Gene Namemaestro heat-like repeat family member 2B
Synonyms4930455B06Rik, Heatr7b2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R8259 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location4898737-4962205 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 4911909 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 308 (V308I)
Ref Sequence ENSEMBL: ENSMUSP00000036148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045736]
Predicted Effect probably benign
Transcript: ENSMUST00000045736
AA Change: V308I

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000036148
Gene: ENSMUSG00000022155
AA Change: V308I

DomainStartEndE-ValueType
low complexity region 124 135 N/A INTRINSIC
low complexity region 824 842 N/A INTRINSIC
SCOP:d1gw5a_ 937 1443 7e-15 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (82/82)
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,682,481 E1206G probably benign Het
Abca15 A T 7: 120,340,199 H272L probably benign Het
Abcg5 T G 17: 84,676,095 T144P possibly damaging Het
Adam34 G A 8: 43,651,609 S333L probably benign Het
Adcy6 A G 15: 98,601,038 F294S probably damaging Het
Adhfe1 A G 1: 9,558,192 N263S probably null Het
Aebp2 A T 6: 140,637,727 Q309L possibly damaging Het
Akap7 A G 10: 25,171,156 Y281H probably damaging Het
Aplf T C 6: 87,630,005 R476G probably benign Het
Atg2a G A 19: 6,249,829 A588T probably damaging Het
Birc6 A G 17: 74,598,078 T1289A probably benign Het
Cacna1d A G 14: 30,051,518 S1759P probably benign Het
Calcoco1 T C 15: 102,715,793 D236G probably damaging Het
Camsap2 A T 1: 136,280,339 D470E probably benign Het
Capn8 G T 1: 182,565,133 V25L probably benign Het
Card10 A G 15: 78,776,684 V1041A probably damaging Het
Ccr1 T A 9: 123,964,082 H137L probably damaging Het
Cdh23 A T 10: 60,315,656 D2483E probably damaging Het
Chd2 G T 7: 73,435,784 Q1701K probably benign Het
Ckmt2 T A 13: 91,859,216 R286S probably damaging Het
Clhc1 G A 11: 29,553,746 R54Q probably benign Het
Cntnap3 T A 13: 64,787,867 D394V probably damaging Het
Comp A G 8: 70,379,054 D441G probably damaging Het
Cyp20a1 G A 1: 60,352,171 probably null Het
Cyp27a1 A T 1: 74,732,055 D133V probably benign Het
Cyp2a12 C T 7: 27,032,658 Q275* probably null Het
Dnhd1 A T 7: 105,694,788 I1780L probably benign Het
Dpy19l2 A G 9: 24,669,406 V213A probably benign Het
Eml1 A T 12: 108,510,199 I283F probably damaging Het
Ep300 A G 15: 81,639,017 T1281A unknown Het
Ercc6l2 G A 13: 63,872,471 E803K Het
Fat3 A G 9: 15,990,591 V3046A possibly damaging Het
Fbxw20 A G 9: 109,234,695 V3A probably benign Het
Fcgr2b A G 1: 170,968,133 S76P possibly damaging Het
Fgg C T 3: 83,010,170 Q169* probably null Het
Flnb A G 14: 7,889,183 Y511C probably damaging Het
Ggt5 G A 10: 75,614,832 V558I probably benign Het
Gm4779 G C X: 101,793,784 T171S possibly damaging Het
Greb1 A T 12: 16,724,924 C157* probably null Het
Grid2ip A G 5: 143,362,589 E145G probably benign Het
Hdac11 T A 6: 91,172,228 V238E probably damaging Het
Herc2 A G 7: 56,205,890 D3858G probably damaging Het
Hoxc4 A G 15: 103,034,739 Y6C probably damaging Het
Incenp A G 19: 9,893,629 L212P unknown Het
Incenp G C 19: 9,893,641 T208R unknown Het
Mctp1 T A 13: 76,801,547 probably null Het
Megf8 T C 7: 25,358,423 M2095T probably benign Het
Muc1 T A 3: 89,232,034 H580Q probably damaging Het
Naip6 A T 13: 100,316,412 M47K probably benign Het
Nectin3 C T 16: 46,436,391 R419Q probably benign Het
Nlrp4g T G 9: 124,353,392 Y579D noncoding transcript Het
Nrxn1 C A 17: 90,163,821 R1260L probably damaging Het
Nynrin A G 14: 55,863,358 I202V possibly damaging Het
Olfr128 T C 17: 37,923,956 L130P probably damaging Het
Olfr1450 T C 19: 12,954,363 M258T possibly damaging Het
Olfr199 T C 16: 59,216,095 I173V probably benign Het
Olfr78 A G 7: 102,742,827 Y59H probably damaging Het
Pard3 G A 8: 127,371,540 W354* probably null Het
Pcnx3 C T 19: 5,665,384 G1946E probably damaging Het
Peak1 A G 9: 56,259,393 V417A probably damaging Het
Prune2 A G 19: 17,212,308 R3052G unknown Het
Prx T C 7: 27,519,383 L1242P probably damaging Het
Pxylp1 A G 9: 96,825,580 I183T probably benign Het
Ranbp2 A G 10: 58,455,933 E254G probably benign Het
Ren1 C T 1: 133,350,796 R31* probably null Het
Rhot2 C A 17: 25,839,890 R512L probably benign Het
Rpa1 T C 11: 75,302,724 N594D probably benign Het
Rpp14 T G 14: 8,090,526 V150G probably null Het
Rxfp2 T A 5: 150,059,900 I300K probably damaging Het
Sbno1 A T 5: 124,381,696 V1173E probably damaging Het
Scarf1 T A 11: 75,523,863 S486T probably damaging Het
Slc24a4 T C 12: 102,254,669 V455A probably damaging Het
Slitrk1 A G 14: 108,911,221 V686A probably benign Het
Ston2 A T 12: 91,641,680 I882N probably benign Het
Syne2 C A 12: 75,949,369 Q2228K possibly damaging Het
Tcf20 A C 15: 82,852,273 F1659C probably damaging Het
Tenm4 G A 7: 96,867,991 G1430S probably damaging Het
Tlr12 C A 4: 128,617,699 A253S probably benign Het
Tmem87a A G 2: 120,397,447 F73S possibly damaging Het
Trpm1 G A 7: 64,269,029 A1590T probably benign Het
Usp13 C T 3: 32,917,599 Q743* probably null Het
Vmn1r184 T A 7: 26,267,261 M144K probably benign Het
Wee2 A G 6: 40,444,180 D68G probably benign Het
Other mutations in Mroh2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Mroh2b APN 15 4899197 missense probably benign
IGL00507:Mroh2b APN 15 4962127 missense probably damaging 1.00
IGL00548:Mroh2b APN 15 4931316 missense probably benign 0.35
IGL00902:Mroh2b APN 15 4915222 missense probably damaging 1.00
IGL00944:Mroh2b APN 15 4951127 splice site probably benign
IGL00954:Mroh2b APN 15 4903054 missense probably damaging 0.99
IGL01015:Mroh2b APN 15 4941542 missense probably damaging 1.00
IGL01134:Mroh2b APN 15 4915152 missense probably benign 0.00
IGL01337:Mroh2b APN 15 4905024 missense probably benign 0.38
IGL01780:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL01919:Mroh2b APN 15 4923688 missense probably benign 0.10
IGL02069:Mroh2b APN 15 4904324 splice site probably benign
IGL02146:Mroh2b APN 15 4951294 splice site probably null
IGL02221:Mroh2b APN 15 4923641 missense probably damaging 1.00
IGL02281:Mroh2b APN 15 4952263 missense probably benign 0.04
IGL02350:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL02357:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL02401:Mroh2b APN 15 4900501 missense possibly damaging 0.71
IGL02427:Mroh2b APN 15 4951560 splice site probably benign
IGL02432:Mroh2b APN 15 4914186 missense probably benign
IGL02582:Mroh2b APN 15 4908515 missense probably damaging 0.98
IGL02632:Mroh2b APN 15 4931101 missense probably damaging 0.99
IGL02741:Mroh2b APN 15 4905632 missense probably benign
IGL02811:Mroh2b APN 15 4915236 missense possibly damaging 0.55
IGL02826:Mroh2b APN 15 4962148 missense probably damaging 0.99
IGL03412:Mroh2b APN 15 4944372 missense probably benign 0.14
PIT4468001:Mroh2b UTSW 15 4912812 missense probably damaging 1.00
R0024:Mroh2b UTSW 15 4925627 missense probably damaging 1.00
R0333:Mroh2b UTSW 15 4931118 missense probably damaging 1.00
R0433:Mroh2b UTSW 15 4941634 missense probably benign 0.01
R0530:Mroh2b UTSW 15 4934395 missense probably damaging 0.97
R1411:Mroh2b UTSW 15 4918317 missense probably damaging 1.00
R1457:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1466:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1466:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1472:Mroh2b UTSW 15 4948655 missense probably benign 0.00
R1525:Mroh2b UTSW 15 4951130 splice site probably null
R1584:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1605:Mroh2b UTSW 15 4945090 missense probably benign 0.08
R1657:Mroh2b UTSW 15 4931043 nonsense probably null
R1671:Mroh2b UTSW 15 4951294 splice site probably null
R1698:Mroh2b UTSW 15 4914140 missense probably benign 0.02
R2002:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R2005:Mroh2b UTSW 15 4917158 missense probably damaging 1.00
R2077:Mroh2b UTSW 15 4944966 missense probably damaging 1.00
R2179:Mroh2b UTSW 15 4921446 critical splice donor site probably null
R2183:Mroh2b UTSW 15 4918225 splice site probably null
R3713:Mroh2b UTSW 15 4943649 missense probably benign 0.01
R3714:Mroh2b UTSW 15 4943649 missense probably benign 0.01
R3747:Mroh2b UTSW 15 4952246 nonsense probably null
R3748:Mroh2b UTSW 15 4952246 nonsense probably null
R3749:Mroh2b UTSW 15 4952246 nonsense probably null
R3750:Mroh2b UTSW 15 4952246 nonsense probably null
R3792:Mroh2b UTSW 15 4923620 missense probably damaging 1.00
R3872:Mroh2b UTSW 15 4925061 nonsense probably null
R4021:Mroh2b UTSW 15 4925100 missense possibly damaging 0.75
R4329:Mroh2b UTSW 15 4931379 missense probably damaging 0.99
R4456:Mroh2b UTSW 15 4947925 missense probably benign 0.21
R4592:Mroh2b UTSW 15 4918290 missense probably damaging 1.00
R4836:Mroh2b UTSW 15 4904270 missense probably damaging 1.00
R5050:Mroh2b UTSW 15 4900450 missense possibly damaging 0.82
R5230:Mroh2b UTSW 15 4941522 missense probably benign 0.07
R5342:Mroh2b UTSW 15 4914133 nonsense probably null
R5353:Mroh2b UTSW 15 4917178 missense probably damaging 1.00
R5368:Mroh2b UTSW 15 4905572 missense probably damaging 1.00
R5424:Mroh2b UTSW 15 4941612 missense probably damaging 0.98
R5484:Mroh2b UTSW 15 4908981 missense possibly damaging 0.92
R5999:Mroh2b UTSW 15 4912884 splice site probably null
R6046:Mroh2b UTSW 15 4951281 missense probably benign 0.01
R6081:Mroh2b UTSW 15 4944377 missense probably damaging 1.00
R6162:Mroh2b UTSW 15 4915225 missense probably damaging 1.00
R6165:Mroh2b UTSW 15 4918350 missense probably benign 0.23
R6240:Mroh2b UTSW 15 4934644 missense probably benign 0.38
R6487:Mroh2b UTSW 15 4947239 missense probably damaging 1.00
R6539:Mroh2b UTSW 15 4905574 missense probably damaging 1.00
R6616:Mroh2b UTSW 15 4953282 missense probably benign 0.36
R6663:Mroh2b UTSW 15 4947935 missense probably benign 0.21
R6820:Mroh2b UTSW 15 4953274 missense probably damaging 1.00
R6900:Mroh2b UTSW 15 4908987 missense probably benign 0.00
R6990:Mroh2b UTSW 15 4912802 missense possibly damaging 0.55
R7067:Mroh2b UTSW 15 4900504 missense probably benign 0.35
R7092:Mroh2b UTSW 15 4934678 missense possibly damaging 0.92
R7102:Mroh2b UTSW 15 4948003 missense probably benign 0.06
R7264:Mroh2b UTSW 15 4921362 missense possibly damaging 0.81
R7436:Mroh2b UTSW 15 4941554 missense probably benign 0.21
R7462:Mroh2b UTSW 15 4908627 missense probably damaging 1.00
R7529:Mroh2b UTSW 15 4949009 missense probably damaging 1.00
R7575:Mroh2b UTSW 15 4934605 missense probably damaging 1.00
R7579:Mroh2b UTSW 15 4931061 missense probably benign 0.09
R7605:Mroh2b UTSW 15 4945023 missense probably damaging 1.00
R7624:Mroh2b UTSW 15 4917131 missense probably damaging 1.00
R7797:Mroh2b UTSW 15 4949105 missense probably benign 0.36
R7848:Mroh2b UTSW 15 4938379 nonsense probably null
R7952:Mroh2b UTSW 15 4951211 missense probably damaging 1.00
R7995:Mroh2b UTSW 15 4921357 nonsense probably null
R8088:Mroh2b UTSW 15 4900503 missense possibly damaging 0.57
R8207:Mroh2b UTSW 15 4938410 missense possibly damaging 0.95
R8242:Mroh2b UTSW 15 4909040 missense probably benign 0.04
R8248:Mroh2b UTSW 15 4931104 missense probably benign 0.40
R8258:Mroh2b UTSW 15 4911909 missense probably benign 0.01
R8304:Mroh2b UTSW 15 4925637 missense probably damaging 0.99
R8316:Mroh2b UTSW 15 4951264 nonsense probably null
R8345:Mroh2b UTSW 15 4944326 missense probably benign 0.09
R8507:Mroh2b UTSW 15 4949090 missense probably damaging 1.00
X0067:Mroh2b UTSW 15 4951591 missense possibly damaging 0.90
Z1177:Mroh2b UTSW 15 4905005 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTCAAGTGGAAATTCCTGTCC -3'
(R):5'- TGCTTAGACAGGGGAGGTTAC -3'

Sequencing Primer
(F):5'- GAAATTCCTGTCCTCTCATTCACAAG -3'
(R):5'- AAGATAGCTTTCCCTCAGTGTGAC -3'
Posted On2020-07-28